معلومة

1.5: التوازن الحمضي القاعدي - علم الأحياء

1.5: التوازن الحمضي القاعدي - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أهداف التعلم

بنهاية هذا القسم ، ستكون قادرًا على:

  • تحديد أقوى نظام عازلة في الجسم
  • اشرح الطريقة التي يؤثر بها الجهاز التنفسي على درجة حموضة الدم

يعتمد الأداء الفسيولوجي السليم على توازن شديد للغاية بين تراكيز الأحماض والقواعد في الدم. يتم قياس توازن التوازن الحمضي باستخدام مقياس الأس الهيدروجيني ، كما هو موضح في. تسمح مجموعة متنوعة من أنظمة التخزين المؤقت للدم وسوائل الجسم الأخرى بالحفاظ على نطاق ضيق لدرجة الحموضة ، حتى في مواجهة الاضطرابات. المخزن المؤقت هو نظام كيميائي يمنع حدوث تغيير جذري في الرقم الهيدروجيني للسائل عن طريق تثبيط التغيير في تركيزات أيون الهيدروجين في حالة زيادة الحمض أو القاعدة. الأكثر شيوعًا ، أن المادة التي تمتص الأيونات هي إما حمض ضعيف ، والذي يأخذ أيونات الهيدروكسيل ، أو قاعدة ضعيفة ، والتي تمتص أيونات الهيدروجين.

الجدول 1. مقياس الأس الهيدروجيني
الرقم الهيدروجينيأمثلة على الحلول
0حمض البطارية ، حمض الهيدروفلوريك القوي
1حمض الهيدروكلوريك يفرز عن طريق بطانة المعدة
2عصير ليمون ، حمض المعدة ، خل
3عصير جريب فروت ، عصير برتقال ، صودا
4عصير الطماطم والأمطار الحمضية
5مياه شرب ناعمة ، قهوة سوداء
6لعاب البول
7"ماء نقي
8مياه البحر
9صودا الخبز
10بحيرة الملح الكبرى ، حليب المغنيسيا
11محلول الأمونيا
12ماء صابون
13مبيض ، منظف الفرن
14منظف ​​الصرف السائل

أنظمة العازلة في الجسم

تعتبر الأنظمة العازلة في جسم الإنسان فعالة للغاية ، وتعمل الأنظمة المختلفة بمعدلات مختلفة. يستغرق الأمر ثوانٍ فقط حتى تقوم المخازن الكيميائية الموجودة في الدم بإجراء تعديلات على درجة الحموضة. يمكن للجهاز التنفسي تعديل درجة الحموضة في الدم لأعلى في دقائق عن طريق زفير ثاني أكسيد الكربون2 من الجسد. يمكن للجهاز الكلوي أيضًا ضبط درجة الحموضة في الدم من خلال إفراز أيونات الهيدروجين (H+) والحفاظ على البيكربونات ، لكن هذه العملية تستغرق ساعات إلى أيام حتى تحدث تأثيرًا.

تشمل الأنظمة العازلة التي تعمل في بلازما الدم بروتينات البلازما والفوسفات والبيكربونات ومخازن حمض الكربونيك. تساعد الكلى في التحكم في التوازن الحمضي القاعدي عن طريق إفراز أيونات الهيدروجين وتوليد البيكربونات التي تساعد في الحفاظ على درجة الحموضة في بلازما الدم ضمن النطاق الطبيعي. تعمل أنظمة عازلة البروتين في الغالب داخل الخلايا.

مخازن البروتين في بلازما الدم والخلايا

يمكن لجميع البروتينات تقريبًا أن تعمل كمخازن مؤقتة. تتكون البروتينات من الأحماض الأمينية التي تحتوي على مجموعات أمينية موجبة الشحنة ومجموعات كربوكسيل سالبة الشحنة. يمكن للمناطق المشحونة من هذه الجزيئات أن تربط أيونات الهيدروجين والهيدروكسيل ، وبالتالي تعمل كمخازن مؤقتة. يمثل التخزين المؤقت بواسطة البروتينات ثلثي قوة التخزين المؤقت للدم ومعظم التخزين المؤقت داخل الخلايا.

الهيموغلوبين كمخزن

الهيموجلوبين هو البروتين الرئيسي داخل خلايا الدم الحمراء ويمثل ثلث كتلة الخلية. أثناء تحويل ثاني أكسيد الكربون2 في البيكربونات ، يتم تخزين أيونات الهيدروجين المحررة في التفاعل بواسطة الهيموجلوبين ، والذي يتم تقليله عن طريق تفكك الأكسجين. يساعد هذا التخزين المؤقت في الحفاظ على درجة الحموضة الطبيعية. تنعكس العملية في الشعيرات الدموية الرئوية لإعادة تكوين ثاني أكسيد الكربون2، والتي يمكن أن تنتشر بعد ذلك في الأكياس الهوائية ليتم زفيرها في الغلاف الجوي. تتم مناقشة هذه العملية بالتفصيل في الفصل الخاص بالجهاز التنفسي.

عازلة حمض بيكربونات الكربونيك

يعمل المخزن المؤقت لحمض البيكربونات والكربونيك بطريقة مشابهة لمخازن الفوسفات. يتم تنظيم البيكربونات في الدم عن طريق الصوديوم ، وكذلك أيونات الفوسفات. عندما يكون بيكربونات الصوديوم (NaHCO3) ، يتلامس مع حمض قوي ، مثل حمض الهيدروكلوريك ، وحمض الكربونيك (H2كو3) ، وهو حمض ضعيف ، ويتكون كلوريد الصوديوم. عندما يتلامس حمض الكربونيك مع قاعدة قوية ، مثل هيدروكسيد الصوديوم والبيكربونات والماء.




كما هو الحال مع محلول الفوسفات ، فإن الحمض الضعيف أو القاعدة الضعيفة تلتقط الأيونات الحرة ، ويتم منع حدوث تغيير كبير في الرقم الهيدروجيني. توجد أيونات البيكربونات وحمض الكربونيك في الدم بنسبة 20: 1 إذا كان الرقم الهيدروجيني في الدم ضمن المعدل الطبيعي. مع وجود بيكربونات أكثر بـ 20 مرة من حمض الكربونيك ، فإن نظام الالتقاط هذا هو الأكثر فعالية في تخزين التغييرات التي قد تجعل الدم أكثر حمضية. هذا مفيد لأن معظم نفايات التمثيل الغذائي في الجسم ، مثل حمض اللاكتيك والكيتونات ، هي أحماض. يتم التحكم في مستويات حمض الكربونيك في الدم عن طريق انتهاء صلاحية ثاني أكسيد الكربون2 من خلال الرئتين. في خلايا الدم الحمراء ، يفرض الأنهيدراز الكربوني تفكك الحمض ، مما يجعل الدم أقل حمضية. بسبب هذا التفكك الحمضي ، CO2 يتم الزفير (انظر المعادلات أعلاه). يتم التحكم في مستوى البيكربونات في الدم من خلال الجهاز الكلوي ، حيث يتم حفظ أيونات البيكربونات في الترشيح الكلوي وإعادتها إلى الدم. ومع ذلك ، فإن المخزن المؤقت للبيكربونات هو نظام التخزين المؤقت الأساسي لـ IF المحيط بالخلايا في الأنسجة في جميع أنحاء الجسم.

تنظيم الجهاز التنفسي لتوازن الحمض القاعدي

يساهم الجهاز التنفسي في توازن الأحماض والقواعد في الجسم عن طريق تنظيم مستويات حمض الكربونيك في الدم. كو2 في الدم يتفاعل بسهولة مع الماء لتكوين حمض الكربونيك ومستويات ثاني أكسيد الكربون2 وحمض الكربونيك في الدم في حالة توازن. عندما CO2 يرتفع المستوى في الدم (كما يحدث عندما تحبس أنفاسك) ، فائض ثاني أكسيد الكربون2 يتفاعل مع الماء لتكوين حمض الكربونيك الإضافي ، مما يقلل من درجة الحموضة في الدم. تسمح لك زيادة معدل و / أو عمق التنفس (الذي قد تشعر "بالحاجة" لفعله بعد حبس أنفاسك) بإخراج المزيد من ثاني أكسيد الكربون2. فقدان ثاني أكسيد الكربون2 من الجسم يقلل من مستويات حمض الكربونيك في الدم وبالتالي يضبط درجة الحموضة لأعلى نحو المستويات الطبيعية. كما قد تظن ، تعمل هذه العملية أيضًا في الاتجاه المعاكس. التنفس العميق والسريع (كما في فرط التنفس) يخلص الدم من ثاني أكسيد الكربون2 ويقلل من مستوى حمض الكربونيك ، مما يجعل الدم قلويًا جدًا. يمكن معالجة هذا القلاء الوجيز عن طريق إعادة تنفس الهواء الذي تم زفيره في كيس ورقي. ستؤدي إعادة تنفس هواء الزفير إلى خفض درجة حموضة الدم بسرعة نحو المعدل الطبيعي.

التفاعلات الكيميائية التي تنظم مستويات ثاني أكسيد الكربون2 وحمض الكربونيك يحدثان في الرئتين عندما ينتقل الدم عبر الشعيرات الدموية الرئوية. عادةً ما تكون التعديلات الطفيفة في التنفس كافية لضبط درجة الحموضة في الدم عن طريق تغيير كمية ثاني أكسيد الكربون2 يتم الزفير. في الواقع ، مضاعفة معدل التنفس لأقل من دقيقة واحدة ، وإزالة ثاني أكسيد الكربون "الإضافي"2، من شأنه أن يزيد من درجة الحموضة في الدم بمقدار 0.2. هذا الموقف شائع إذا كنت تمارس الرياضة بشكل شاق على مدى فترة من الزمن. للحفاظ على إنتاج الطاقة اللازم ، ستنتج فائضًا من ثاني أكسيد الكربون2 (وحمض اللاكتيك إذا كنت تمارس تمارين رياضية تتجاوز العتبة الهوائية). من أجل موازنة زيادة إنتاج الحمض ، يرتفع معدل التنفس لإزالة ثاني أكسيد الكربون2. هذا يساعد على حمايتك من الإصابة بالحماض.

ينظم الجسم معدل التنفس عن طريق استخدام المستقبلات الكيميائية ، والتي تستخدم في المقام الأول ثاني أكسيد الكربون2 كإشارة. توجد مستشعرات الدم المحيطية في جدران الشريان الأورطي والشرايين السباتية. تشير هذه المستشعرات إلى الدماغ لتوفير تعديلات فورية لمعدل التنفس في حالة ثاني أكسيد الكربون2 المستويات ترتفع أو تنخفض. ومع ذلك ، توجد مستشعرات أخرى في الدماغ نفسه. تؤثر التغييرات في درجة الحموضة في السائل الدماغي النخاعي على مركز الجهاز التنفسي في النخاع المستطيل ، والذي يمكن أن يعدل بشكل مباشر معدل التنفس لإعادة درجة الحموضة إلى المعدل الطبيعي.

فرط ثنائي أكسيد الكربون، أو ارتفاع مستويات ثاني أكسيد الكربون في الدم بشكل غير طبيعي2، يحدث في أي حالة تضعف وظائف الجهاز التنفسي ، بما في ذلك الالتهاب الرئوي وفشل القلب الاحتقاني. يمكن أن يؤدي أيضًا انخفاض التنفس (نقص التهوية) بسبب الأدوية مثل المورفين أو الباربيتورات أو الإيثانول (أو حتى مجرد حبس النفس) إلى فرط ثنائي أكسيد الكربون. هيبوكابنيا، أو انخفاض مستويات ثاني أكسيد الكربون في الدم بشكل غير طبيعي2، يحدث لأي سبب من أسباب فرط التهوية الذي يخرج من ثاني أكسيد الكربون2، مثل تسمم الساليسيلات أو ارتفاع درجات حرارة الغرفة أو الحمى أو الهستيريا.

التنظيم الكلوي لتوازن الحمض القاعدي

يعالج التنظيم الكلوي للتوازن الحمضي القاعدي في الجسم المكون الأيضي لنظام التخزين المؤقت. بينما يتحكم الجهاز التنفسي (جنبًا إلى جنب مع مراكز التنفس في الدماغ) في مستويات حمض الكربونيك في الدم عن طريق التحكم في زفير ثاني أكسيد الكربون2يتحكم الجهاز الكلوي في مستويات البيكربونات في الدم. يمكن أن ينتج نقص بيكربونات الدم عن تثبيط الأنهيدراز الكربوني بواسطة بعض مدرات البول أو من الفقد المفرط للبيكربونات بسبب الإسهال. عادةً ما تكون مستويات بيكربونات الدم أقل عند الأشخاص المصابين بمرض أديسون (قصور الغدة الكظرية المزمن) ، حيث تنخفض مستويات الألدوستيرون ، وفي الأشخاص الذين يعانون من تلف كلوي ، مثل التهاب الكلية المزمن. أخيرًا ، يمكن أن ينتج انخفاض مستويات البيكربونات في الدم عن مستويات مرتفعة من الكيتونات (شائعة في داء السكري غير المُدار) ، والتي تربط البيكربونات في المرشح وتمنع حفظها.

أيونات بيكربونات ، HCO3، الموجودة في المرشح ، ضرورية لنظام عازلة البيكربونات ، ومع ذلك فإن خلايا النبيبات ليست منفذة لأيونات البيكربونات. يتم عرض الخطوات المتبعة في تزويد أيونات البيكربونات للنظام في الرسم البياني السابق وتم تلخيصها أدناه:

  • الخطوة 1: يعاد امتصاص أيونات الصوديوم من المرشح مقابل H2+ بواسطة آلية موانع في الأغشية القمية للخلايا المبطنة للنبيب الكلوي.
  • الخطوة 2: تنتج الخلايا أيونات البيكربونات التي يمكن تحويلها إلى الشعيرات الدموية المحيطة بالنبيبات.
  • الخطوة 3: عندما CO2 متوفر ، يكون التفاعل مدفوعًا إلى تكوين حمض الكربونيك ، الذي ينفصل ليشكل أيون بيكربونات وأيون هيدروجين.
  • الخطوة 4: يمر أيون البيكربونات في الشعيرات الدموية حول الأنبوب ويعود إلى الدم. يفرز أيون الهيدروجين في المرشح ، حيث يمكن أن يصبح جزءًا من جزيئات الماء الجديدة ويعاد امتصاصه على هذا النحو ، أو إزالته في البول.

من الممكن أيضًا أن تلتقط الأملاح الموجودة في المرشح ، مثل الكبريتات أو الفوسفات أو الأمونيا ، أيونات الهيدروجين. في حالة حدوث ذلك ، لن تكون أيونات الهيدروجين متاحة للاندماج مع أيونات البيكربونات وإنتاج ثاني أكسيد الكربون2. في مثل هذه الحالات ، لا يتم حفظ أيونات البيكربونات من المرشح إلى الدم ، مما يساهم أيضًا في اختلال توازن الأس الهيدروجيني والحماض.

تتنافس أيونات الهيدروجين أيضًا مع البوتاسيوم للتبادل مع الصوديوم في الأنابيب الكلوية. إذا كان البوتاسيوم موجودًا أكثر من الطبيعي ، فسيتم تبادل البوتاسيوم ، بدلاً من أيونات الهيدروجين ، ويدخل البوتاسيوم المتزايد إلى المرشح. عند حدوث ذلك ، يشارك عدد أقل من أيونات الهيدروجين في المرشح في تحويل البيكربونات إلى ثاني أكسيد الكربون2 ويتم حفظ كمية أقل من البيكربونات. إذا كان هناك كمية أقل من البوتاسيوم ، تدخل المزيد من أيونات الهيدروجين إلى المرشح ليتم تبادلها مع الصوديوم ويتم الحفاظ على المزيد من البيكربونات.

تعتبر أيونات الكلوريد مهمة في تحييد الشحنات الأيونية الإيجابية في الجسم. في حالة فقد الكلوريد ، يستخدم الجسم أيونات البيكربونات بدلاً من أيونات الكلوريد المفقودة. وبالتالي ، يؤدي فقد الكلوريد إلى زيادة امتصاص البيكربونات من قبل الجهاز الكلوي.

اضطرابات التوازن الحمضي القاعدي: الحماض الكيتوني

يحدث الحماض السكري ، أو الحماض الكيتوني ، بشكل متكرر عند الأشخاص المصابين بداء السكري الذي لا يتم التحكم فيه بشكل جيد. عندما لا تستطيع أنسجة معينة في الجسم الحصول على كميات كافية من الجلوكوز ، فإنها تعتمد على تكسير الأحماض الدهنية للحصول على الطاقة. عندما تقطع مجموعات الأسيتيل سلاسل الأحماض الدهنية ، تتحد مجموعات الأسيتيل بعد ذلك بشكل غير إنزيمي لتكوين أجسام كيتونية ، وحمض أسيتو أسيتيك ، وحمض بيتا هيدروكسي بيوتيريك ، وأسيتون ، وكلها تزيد من حموضة الدم. في هذه الحالة ، لا يتم تزويد الدماغ بما يكفي من وقوده - الجلوكوز - لإنتاج كل الـ ATP الذي يحتاجه ليعمل.

يمكن أن يكون الحماض الكيتوني شديدًا ، وإذا لم يتم اكتشافه وعلاجه بشكل صحيح ، يمكن أن يؤدي إلى غيبوبة السكري ، والتي يمكن أن تكون قاتلة. من الأعراض المبكرة الشائعة للحماض الكيتوني التنفس العميق والسريع حيث يحاول الجسم التخلص من ثاني أكسيد الكربون2 وتعويض الحماض. من الأعراض الشائعة الأخرى رائحة الفم الكريهة بسبب زفير الأسيتون. تشمل الأعراض الأخرى جفاف الجلد والفم واحمرار الوجه والغثيان والقيء وآلام المعدة. علاج غيبوبة السكري هو تناول أو حقن السكر. الوقاية منه هي إعطاء الأنسولين اليومي السليم.

يمكن لأي شخص مصاب بداء السكري ويستخدم الأنسولين أن يبدأ بالحماض الكيتوني إذا ضاعت جرعة من الأنسولين. من بين الأشخاص المصابين بداء السكري من النوع 2 ، فإن الأشخاص المنحدرين من أصل إسباني وأمريكي من أصل أفريقي هم أكثر عرضة للإصابة بالحماض الكيتوني أكثر من أولئك الذين ينتمون إلى خلفيات عرقية أخرى ، على الرغم من أن سبب ذلك غير معروف.

مراجعة الفصل

توجد مجموعة متنوعة من أنظمة التخزين المؤقت في الجسم تساعد في الحفاظ على الرقم الهيدروجيني للدم والسوائل الأخرى ضمن نطاق ضيق - بين الرقم الهيدروجيني 7.35 و 7.45. المخزن المؤقت هو مادة تمنع حدوث تغيير جذري في درجة الحموضة في السائل عن طريق امتصاص أيونات الهيدروجين أو الهيدروكسيل الزائدة. الأكثر شيوعًا ، أن المادة التي تمتص الأيونات هي إما حمض ضعيف ، والذي يأخذ أيون الهيدروكسيل (OH) ، أو قاعدة ضعيفة ، والتي تأخذ أيون الهيدروجين (H+). تعمل العديد من المواد كمواد عازلة في الجسم ، بما في ذلك بروتينات الخلايا والبلازما والهيموجلوبين والفوسفات وأيونات البيكربونات وحمض الكربونيك. المخزن المؤقت للبيكربونات هو نظام التخزين المؤقت الأساسي لـ IF المحيط بالخلايا في الأنسجة في جميع أنحاء الجسم. يلعب الجهاز التنفسي والكلى أيضًا دورًا رئيسيًا في التوازن الحمضي القاعدي عن طريق إزالة ثاني أكسيد الكربون2 وأيونات الهيدروجين ، على التوالي ، من الجسم.

الاختيار الذاتي

أجب عن السؤال (الأسئلة) أدناه لمعرفة مدى فهمك للموضوعات التي تم تناولها في القسم السابق.

أسئلة التفكير النقدي

  1. وصف حفظ أيونات البيكربونات في الجهاز الكلوي.
  2. وصف التحكم في مستويات حمض الكربونيك في الدم من خلال الجهاز التنفسي.

[تكشف-الإجابة q = ”635497 ″] إظهار الإجابات [/ تكشف-الإجابة]
[إجابة مخفية أ = ”635497 ″]

  1. يتم ترشيح أيونات البيكربونات بحرية من خلال الكبيبة. لا يمكن أن تمر بحرية في الخلايا الأنبوبية الكلوية ويجب تحويلها إلى ثاني أكسيد الكربون2 في المرشح ، والذي يمكن أن يمر عبر غشاء الخلية. يتم إعادة امتصاص أيونات الصوديوم في الغشاء ، ويتم طرد أيونات الهيدروجين في المرشح. تتحد أيونات الهيدروجين مع البيكربونات مكونة حمض الكربونيك الذي يتفكك في ثاني أكسيد الكربون2 الغاز والماء. ينتشر الغاز في الخلايا الكلوية حيث يحفز الأنهيدراز الكربوني تحويله مرة أخرى إلى أيون بيكربونات يدخل الدم.
  2. يتم التحكم في مستويات حمض الكربونيك في الدم من خلال الجهاز التنفسي عن طريق طرد ثاني أكسيد الكربون2 من الرئتين. تكون صيغة إنتاج أيونات البيكربونات قابلة للعكس إذا كان تركيز ثاني أكسيد الكربون2 النقصان. عندما يحدث هذا في الرئتين ، يتحول حمض الكربونيك إلى غاز ، وينخفض ​​تركيز الحمض. يحدد معدل التنفس كمية ثاني أكسيد الكربون2 الزفير. إذا زاد المعدل ، يكون حمض الدم أقل ؛ إذا انخفض المعدل ، يمكن أن يصبح الدم أكثر حمضية.

[/ إجابة مخفية]

قائمة المصطلحات

فرط ثنائي أكسيد الكربون: ارتفاع غير طبيعي في مستويات ثاني أكسيد الكربون في الدم2

hypocapnia: انخفاض مستويات ثاني أكسيد الكربون في الدم بشكل غير طبيعي2


معادلة هندرسون هاسلبالش

كل طبيب يتعامل مع التشوهات الحمضية القاعدية على دراية بمعادلة هندرسون-هاسلبالش ، والتي ربما تكون أشهر معادلة في علم الأحياء. لسوء الحظ ، لا يدرك معظم الأطباء قيود هذه المعادلة: فهي تحتوي على عدد من الحالات الشاذة وهي وصفية أكثر من كونها آلية.

يركز النهج التقليدي لتقييم التوازن الحمضي القاعدي على كيفية توتر ثاني أكسيد الكربون في البلازما (P co 2) ، تركيز بيكربونات البلازما ([HCO3 -]) ، اللوغاريتم السالب لثابت التفكك الظاهري (صك1′) لحمض الكربونيك (H2كو3) في البلازما وقابلية الذوبان (س) من CO2 في البلازما تتفاعل لتحديد درجة الحموضة في البلازما. يكون تفاعل التوازن كما يلي:

عند التوازن ، يمكن التعبير عن العلاقة بمعادلة هندرسون-هاسلبالش ، على النحو التالي 2 ، 14:

أثبتت معادلة Henderson-Hasselbalch أنها لا تقدر بثمن في المساعدة على فهم فسيولوجيا قاعدة حمض الثدييات وتستخدم بشكل روتيني في علاج تشوهات القاعدة الحمضية. مع نهج هندرسون-هاسلبالش التقليدي ، تم تحديد الاضطرابات الحمضية الأولية التالية (الأشكال 111-1 و111-2) 15:

الحماض التنفسي (زيادة P co 2)

قلاء في الجهاز التنفسي (انخفاض ف 2)

الحماض الأيضي (انخفاض القاعدة الزائدة خارج الخلية ، HCO الفعلي3 - التركيز ، أو HCO القياسي3 - [تركيز البيكربونات في ظل الظروف القياسية])

قلاء استقلابي (زيادة القاعدة الزائدة خارج الخلية ، HCO الفعلي3 - التركيز ، أو HCO القياسي3 − )

كان من الواضح في وقت مبكر من عام 1922 أن هناك عوامل أخرى غير P co 2، [HCO3 -] ، صك1'، و س تأثير البلازما pH. 16 في عام 1925 ، صك1(وبالتالي الرقم الهيدروجيني) يتأثر بالقوة الأيونية (μ) 17 ودرجة الحرارة ، 18 Δك1′ / ΔT يجري −0.005 وحدة / درجة مئوية على مدى درجة حرارة من 20 درجة إلى 38 درجة مئوية.ك1′ ، مثل جميع ثوابت التوازن القائمة على المولات ، يمكن تغييرها من خلال التغيرات في القوة الأيونية ودرجة الحرارة. ومع ذلك ، فقد وجد بشكل غير متوقع أن ΔpH / T المقاس للبلازما كان −0.015 إلى −0.020 وحدة / درجة مئوية ، وهي قيمة من ثلاثة إلى أربعة أضعاف 0.005 وحدة / درجة مئوية تنبأ بها pك1′. 6 تُظهر هذه النتيجة أن معادلة هندرسون-هاسلبالش لا يمكن تطبيقها بدقة على دم الثدييات المبرد في المختبر أو على الحيوانات شديدة الحرارة.

تحديد ص دقيقةك1كانت قيم ′ للبلازما أكثر إشكالية ، لأن القيمة التجريبية لـ pك1′ (ثابت التفكك الظاهر) في البلازما يختلف هامشيًا عن القيمة التي تم الحصول عليها في المحاليل المائية غير البلازمية. أظهر عدد من الدراسات أن قيمة pك1′ في البلازما يتأثر بالرقم الهيدروجيني وتركيز البروتين وتركيز الصوديوم. 19-22 على الرغم من أن هذه الملاحظات أزعجت معظم الباحثين ، إلا أن قيمة pك1يتم تعديل ′ في البلازما بشكل روتيني من خلال استخدام المخططات ، والجداول ، أو المعادلات متعددة الحدود لحساب التغيرات في درجة الحموضة في البلازما ، وتركيز البروتين ، وتركيز الصوديوم. الأساس الآلي لهذه التعديلات غير معروف حاليًا.

قيمة pك1′ بقوة أيونية قدرها 0.16 (سائل خارج الخلية في الثدييات) يتم الحصول عليها من مجموع pكس (ثابت التفكك الظاهري) (6.029 عند 37 درجة مئوية) 19 واللوغاريتم السالب لمعامل نشاط أيون الهيدروجين (0.091) ، 22 ينتج عنه قيمة 6.120 عند 37 درجة مئوية.ك1′ يجب تصحيحه من حيث درجة الحرارة والقوة الأيونية فقط عند تطبيقه على السوائل البيولوجية. القيمة المستخدمة ل س في البلازما عند 37 درجة مئوية هو 0.0307 ملم زئبق -1 س يختلف باختلاف القوة الأيونية ودرجة الحرارة وتركيز البروتين ، وتتوفر قيم دقيقة لبلازما الثدييات. 23

نظرًا لأن معادلة Henderson-Hasselbalch لا تفسر بشكل مرضٍ الاعتماد على درجة حرارة الرقم الهيدروجيني للبلازما أو للاعتماد الواضح على pك1′ في البلازما على الأس الهيدروجيني وتركيز البروتين وتركيز الصوديوم ، يمكن تطبيق هذا النهج بدقة على دم الثدييات فقط في درجات حرارة الجسم العادية ودرجة الحموضة الطبيعية تقريبًا وتركيز البروتين وتركيز الصوديوم. الطبيعة التجريبية للتعديلات على قيمة pك1تشير ′ في البلازما إلى أن معادلة هندرسون-هاسلبالش وصفية أكثر من كونها ميكانيكية. لذلك من المستحسن اتباع نهج أكثر آلية ، وتوفر نظرية فرق الأيونات القوية مثل هذا النموذج.


1.5: التوازن الحمضي القاعدي - علم الأحياء

تلعب الإلكتروليتات دورًا حيويًا في الحفاظ على التوازن داخل الجسم.

أهداف التعلم

التعرف على أهمية توازن الصوديوم والسوائل / الإلكتروليت

الماخذ الرئيسية

النقاط الرئيسية

  • تساعد الكهارل على تنظيم وظائف عضلة القلب والعصبية ، وتوازن السوائل ، وتوصيل الأكسجين ، والتوازن الحمضي القاعدي ، وغير ذلك الكثير.
  • تتضمن أخطر اضطرابات الإلكتروليتات شذوذًا في مستويات الصوديوم و / أو البوتاسيوم و / أو الكالسيوم.
  • تعمل الكلى على إبقاء تركيزات الكهارل في الدم ثابتة على الرغم من التغيرات في الجسم.

الشروط الاساسية

  • التوازن: قدرة نظام أو كائن حي على ضبط بيئته الداخلية للحفاظ على توازن مستقر مثل قدرة الحيوانات ذوات الدم الحار على الحفاظ على درجة حرارة ثابتة.
  • بالكهرباء: أي من الأيونات المختلفة (مثل الصوديوم أو الكلوريد) التي تنظم الشحنات الكهربائية على الخلايا وتدفق الماء عبر أغشيتها.
  • صوديوم: عنصر كيميائي برمز Na (من اللاتينية: natrium) ورقم ذري 11. وهو معدن ناعم ، فضي اللون ، شديد التفاعل وهو عضو في الفلزات القلوية.

أهمية ميزان المنحل بالكهرباء

تلعب الإلكتروليتات دورًا حيويًا في الحفاظ على التوازن داخل الجسم. فهي تساعد في تنظيم وظائف عضلة القلب والعصبية ، وتوازن السوائل ، وتوصيل الأكسجين ، والتوازن الحمضي القاعدي ، والعمليات البيولوجية الأخرى.

تعتبر الإلكتروليتات مهمة لأنها الخلايا (خاصة تلك الموجودة في العصب والقلب والعضلات) تستخدمها للحفاظ على الفولتية عبر أغشية الخلايا وحمل النبضات الكهربائية (النبضات العصبية وتقلصات العضلات) عبر نفسها وإلى الخلايا الأخرى.

يمكن أن تتطور اختلالات الإلكتروليت من الإفراط في تناول الطعام أو تناقصه ومن الإفراط في التخلص من الإلكتروليت أو تناقصه. السبب الأكثر شيوعًا لاضطرابات الكهارل هو الفشل الكلوي. تتضمن أخطر اضطرابات الإلكتروليتات شذوذًا في مستويات الصوديوم و / أو البوتاسيوم و / أو الكالسيوم.

الاختلالات الأخرى للكهارل أقل شيوعًا ، وغالبًا ما تحدث بالتزامن مع تغيرات كبيرة في الإلكتروليت. يمكن أن يؤدي تعاطي الملينات المزمنة أو الإسهال الشديد أو القيء (التهاب المعدة والأمعاء) إلى اضطرابات بالكهرباء مصحوبة بالجفاف. الأشخاص الذين يعانون من الشره المرضي أو فقدان الشهية العصبي معرضون بشكل خاص لخطر كبير لاختلال توازن الكهارل.

تعمل الكلى على الحفاظ على ثبات تركيزات الكهارل في الدم على الرغم من التغيرات التي تطرأ على جسمك. على سبيل المثال ، أثناء ممارسة التمارين الرياضية الثقيلة ، يتم فقدان الإلكتروليتات من خلال التعرق ، وخاصة الصوديوم والبوتاسيوم ، ويمكن أن يؤدي التعرق إلى زيادة الحاجة إلى تعويض الإلكتروليت (الملح). من الضروري استبدال هذه الإلكتروليتات للحفاظ على ثبات تركيزاتها في سوائل الجسم.

تجفيف

هناك ثلاثة أنواع من الجفاف:

  1. ناقص التوتر أو نقص صوديوم الدم (بشكل أساسي فقدان الإلكتروليتات والصوديوم على وجه الخصوص).
  2. مفرط التوتر أو مفرط صوديوم الدم (بشكل أساسي فقدان الماء).
  3. متساوي التوتر أو متساوي الصوديوم (خسارة متساوية للماء والكهارل).

في البشر ، النوع الأكثر شيوعًا من الجفاف إلى حد بعيد هو الجفاف المتساوي التوتر (isonatraemic) الذي يعادل بشكل فعال نقص حجم الدم ولكن التمييز بين الجفاف المتساوي التوتر والجفاف مفرط التوتر قد يكون مهمًا عند علاج الأشخاص المصابين بالجفاف.

من الناحية الفسيولوجية ، وعلى الرغم من الاسم ، فإن الجفاف لا يعني ببساطة فقدان الماء ، حيث يفقد كل من الماء والمواد المذابة (الصوديوم بشكل أساسي) بكميات متساوية تقريبًا فيما يتعلق بكيفية وجودهما في بلازما الدم. في حالة الجفاف الخافض للتوتر ، ينتقل الماء داخل الأوعية إلى الفضاء خارج الأوعية الدموية ويؤدي إلى تضخيم استنفاد الحجم داخل الأوعية لمقدار معين من فقدان الماء الكلي بالجسم.

يمكن أن تحدث المضاعفات العصبية في حالات نقص التوتر وفرط التوتر. يمكن أن يؤدي الأول إلى نوبات ، في حين أن الأخير يمكن أن يؤدي إلى وذمة دماغية تناضحية عند الإماهة السريعة.

في الحالات الأكثر شدة ، يتم تصحيح حالة الجفاف عن طريق تجديد الماء والكهارل الضرورية (من خلال علاج الجفاف عن طريق الفم أو استبدال السوائل عن طريق العلاج عن طريق الوريد). نظرًا لأن معالجة الجفاف عن طريق الفم أقل إيلامًا وأقل توغلاً وأقل تكلفة وأسهل في توفيرها ، فهي العلاج المفضل للجفاف الخفيف. يجب أن تكون المحاليل المستخدمة في معالجة الجفاف عن طريق الوريد متساوية التوتر أو منخفضة التوتر.

شوارد الخلية: يوضح هذا الرسم البياني آلية نقل الماء والشوارد عبر الخلايا الظهارية في الغدد الإفرازية.


تشخيص نقص بوتاسيوم الدم: نهج حل المشكلات للحالات السريرية

في الحالات التي يكون فيها سبب نقص بوتاسيوم الدم غير واضح ، غالبًا ما يكون قياس إفراز البوتاسيوم في البول وضغط الدم وتقييم التوازن الحمضي القاعدي مفيدًا. تشير نسبة البوتاسيوم والكرياتينين العشوائية في البول (K / C) أقل من 1.5 إلى سوء تناول الطعام ، أو فقدان الجهاز الهضمي ، أو تحول البوتاسيوم إلى الخلايا. إذا كان نقص بوتاسيوم الدم مرتبطًا بالشلل ، يجب أن نأخذ في الاعتبار فرط نشاط الغدة الدرقية ، والشلل الدوري العائلي أو المتقطع. يشير الحماض الأيضي مع نسبة K / C في البول أقل من 1.5 إلى انخفاض خسائر الجهاز الهضمي بسبب الإسهال أو تعاطي الملينات. غالبًا ما يكون الحماض الأيضي مع نسبة K / C أعلى من 1.5 بسبب الحماض الكيتوني السكري أو النوع 1 أو النوع 2 من الحماض الأنبوبي الكلوي البعيد. غالبًا ما يكون القلاء الاستقلابي مع نسبة K / C أقل من 1.5 وضغط الدم الطبيعي بسبب القيء الخفي. يشير القلاء الاستقلابي مع ارتفاع نسبة K / C وضغط الدم الطبيعي إلى استخدام مدر للبول أو متلازمة بارتر أو متلازمة جيتلمان. يشير القلاء الاستقلابي مع ارتفاع نسبة K / C في البول وارتفاع ضغط الدم إلى فرط الألدوستيرونية الأولي ، أو متلازمة كوشينغ ، أو تضخم الغدة الكظرية الخلقي ، أو تضيق الشريان الكلوي ، أو زيادة القشرانيات المعدنية الظاهرة ، أو متلازمة ليدل. يمكن أن يؤدي نقص مغنسيوم الدم إلى زيادة فقد البوتاسيوم في البول ونقص بوتاسيوم الدم. يعتمد التفاضل على قياس مستويات المغنيسيوم في الدم والألدوستيرون والرينين ، وشاشة مدر البول في البول ، والاستجابة لسبيرونولاكتون وأميلوريد ، وقياس مستوى الكورتيزول في البلازما ونسبة الكورتيزول والكورتيزون البولي ، والاختبار الجيني.


الأهمية السريرية

القلاء الاستقلابي هو تشخيص شائع نسبيًا في الطب. تنتج التأثيرات البيولوجية للقلاء الأيضي بشكل مباشر عن المشاكل المصاحبة & # x000a0 مثل نقص حجم الدم واستنفاد البوتاسيوم والكلوريد. تؤدي هذه التغييرات إلى انخفاض انقباض عضلة القلب ، وعدم انتظام ضربات القلب ، وانخفاض تدفق الدم في المخ ، والارتباك ، وزيادة الاستثارة العصبية العضلية ، وضعف تفريغ الأكسجين المحيطي نتيجة تحول منحنى تفكك الأكسجين إلى اليسار. & # x000a0 بالإضافة إلى ذلك ، هناك زيادة تعويضية في الشرايين pCO من خلال نقص التهوية. بشكل عام ، هناك تأثير صافٍ على الجسم ينتج عنه نقص الأكسجة.

سريريًا ، من المهم فهم العلاقات بين ثاني أكسيد الكربون والبيكربونات في نظام التخزين المؤقت وفهم تفاعلات كيفية تنظيم هذه المكونات. بالإضافة إلى ذلك ، من الضروري فهم الآلية التي من خلالها يعمل الصوديوم والبوتاسيوم والهيدروجين على تعديل الرقم الهيدروجيني عندما يتم تغيير هذه القنوات الأيونية مع الأدوية. لذلك ، فإن علاج القلاء الأيضي المقاوم للكلوريد يركز على علاج الحالة الأساسية التي أدت إلى حدوث الحدث القلوي. نظرًا لأن العديد من هذه الأمراض ناتجة عن التأثير على نظام الرينين-أنجيوتنسين-الألدوستيرون ، فإن العلاج يشمل تثبيط تأثير الألدوستيرون على النيفرون باستخدام مدرات البول الموفرة للبوتاسيوم مثل أميلوريد وتريامتيرين. بالإضافة إلى ذلك ، ينبغي النظر في إجراء تحقيق عن مصدر خبيث ، مثل فرط الألدوستيرونية الأولية ومتلازمة كون. في القلاء الأيضي المستجيب للكلوريد ، يشمل ذلك امتلاء الشوارد ، وخاصة الكلوريد والبوتاسيوم إلى جانب تجديد السوائل. في السيناريوهات ، مثل قصور القلب الاحتقاني (CHF) أو حالات الوذمة ، يعد إدرار البول ضروريًا باستخدام مدرات البول التي تقتصد البوتاسيوم.


نقاش

أثبت هذا VNBE أنه تجربة معملية ناجحة تتجنب قضايا السلامة الأحيائية المتعلقة بجمع البول والتعامل معه والتخلص منه ويمكن استخدامه بسهولة في العديد من دورات الكيمياء الحيوية لتيارات متعددة من الفصول الكبيرة. من المثير للاهتمام أنه تم وصف تمارين أخرى باستخدام محاكاة البول [11 ، 12] كما أنها تتجنب أي مخاطر صحية محتملة وتتغلب على المشكلات الأخلاقية المتعلقة باستخدام الحيوانات في التدريس. في تمرين واحد [12] ، تم اقتراح Guarurine ، وهو محاكاة للبول يحتوي على مستويات مختلفة من الجلوكوز والكيتونات التي تمثل مرضى مختلفين ، لتعليم تحليل البول لمرضى السكر. في [11] الأخرى ، تتم محاكاة العينات لتقليد تأثيرات التوازن الحمضي القاعدي ويحدد الطلاب الحموضة القابلة للمعايرة. نتصور أن هذه التمارين جنبًا إلى جنب مع تماريننا يمكن أن تشكل أساسًا لمجموعة شاملة من التمارين المحاكاة التي تغطي العديد من جوانب التمثيل الغذائي.

ميزة أخرى لهذا VNBE هي أنه يتجنب الأخطاء الكامنة في تقدير تناول البروتين الغذائي من السجلات الغذائية وفي جمع عينات البول على مدار 24 ساعة. لقد وجدنا أنه في التجارب الصفية ، كان من الصعب للغاية تقليل هذه الأخطاء والتحكم فيها. يتغلب VNBE على الإحباطات التي عانى منها الطلاب سابقًا مع تحديد توازن النيتروجين بدقة كافية لاستخلاص استنتاجات ذات مغزى. لم تكن الدقة التي يمكن للطلاب من خلالها الحصول على نفس القيمة لعينة واحدة عالية جدًا ، حتى بالنسبة لـ VNBE كما يتضح من متوسط ​​معامل الاختلاف بنسبة 17 ٪ (النطاق 8-33 ٪) ، وربما يكون انعكاسًا لقلة الخبرة من الطلاب بهذه التقنيات الجديدة.


تشخيص حمض الأيض واضطرابات # x2013Base في المرضى المصابين بأمراض خطيرة

قارنا طريقتين تشخيصيتين شائعتين ، أحدهما يعتمد على تركيز بيكربونات البلازما و "فجوة الأنيون" ، والآخر على "فائض القاعدة" ، مع طريقة ثالثة تعتمد على المبادئ الفيزيائية والكيميائية ، لقيمتها في اكتشاف الاضطرابات الأيضية المعقدة للحمض والقاعدة. قمنا بتحليل عينات الدم الشرياني من 152 مريضًا وتسعة أشخاص عاديين من أجل الرقم الهيدروجيني ، P co 2، وتركيزات الإلكتروليتات والبروتينات في البلازما. ستة وتسعون في المائة من المرضى لديهم تركيز ألبومين مصل 3 SD أقل من متوسط ​​الأشخاص الضابطين. في حوالي سدس المرضى ، كانت الزيادة القاعدية وبيكربونات البلازما طبيعية. في الغالبية العظمى من هذه العينات التي تبدو طبيعية ، اكتشفت الطريقة الثالثة وجودًا متزامنًا لاضطرابات حامضية وقلوية ، وكثير منها خطير. أدى نقص ألبومين الدم في كل مكان تقريبًا إلى إرباك تفسير البيانات الحمضية القاعدية عند تطبيق الأساليب التقليدية. فقدت القاعدة الزائدة شذوذًا خطيرًا في القاعدة الحمضية في حوالي سدس المرضى تفشل هذه الطريقة عندما تكون تركيزات البلازما للمخازن المؤقتة غير البيكربونات (الزلال بشكل رئيسي) غير طبيعية. اكتشفت فجوة الأنيون "حماض فجوة" مخفي في 31٪ فقط من تلك العينات التي تحتوي على بيكربونات البلازما الطبيعي حيث تم تشخيص هذا الحماض بالطريقة الثالثة عند تعديله من أجل نقص ألبومين الدم ، فقد اكتشف بشكل موثوق الأنيونات المخفية غير الطبيعية. الطريقة الثالثة المقترحة تحدد وتقيس المكونات الفردية للتشوهات الحمضية والقاعدية المعقدة وتوفر رؤى حول كيفية إحداثها.

يتم استخدام نظامين للتشخيص بشكل شائع لتفسير البيانات الحمضية القاعدية. يركز أحدهما على تركيز بيكربونات البلازما ([HCO3 -]) (1) و "فجوة الأنيون" (AG) (2) ، والآخر على "فائض / عجز أساسي" (BE) (3). لا يعزو هذان النظامان دورًا واضحًا للتركيزات غير الطبيعية للمخازن المؤقتة الخالية من البيكربونات في البلازما في التسبب في الاضطرابات غير التنفسية (الأيضية) الحمضية القاعدية. نحن نفترض أنه بسبب هذا الإغفال ، يمكن تفويت شذوذ حمض الأيض الأساسي في الاضطرابات المعقدة التي تظهر في المرضى المصابين بأمراض خطيرة.

إن "المحاليل غير الكربونية" الرئيسية في بلازما الدم هي بروتينات البلازما (4) عنصر آخر (ثانوي) من هذا النظام العازل هو الفوسفات غير العضوي (Pi) (5). من بين بروتينات البلازما ، يشترك ألبومين المصل في التوازن الكيميائي الذي يحدد الحالة الحمضية القاعدية للبلازما ، من خلال حمل شحنة سالبة صافية متغيرة عند قيم الأس الهيدروجيني المتوافقة مع الحياة (6 ، 7). نظرًا لأن هذه الشحنة السالبة تظهر في الحياد الإلكتروني للبلازما ، يمكن اعتبار الجزيء البرمائي للألبومين بمثابة حمض ضعيف غير متطاير في التوازن الكيميائي للبلازما. لا تحمل الجلوبيولين الطبيعي في المصل شحنة كهربائية صافية كبيرة عند قيم الأس الهيدروجيني السائدة في البلازما (6 ، 7).

نقص ألبومين الدم هو اكتشاف شائع في المرضى المصابين بأمراض خطيرة (8) قد يربك التفسير المعتاد للبيانات الحمضية القاعدية ، بسبب مساهمة الألبومين في التوازن الحمضي القاعدي في البلازما. على وجه الخصوص ، في نظام التشخيص الذي يعتمد على البلازما [HCO3 -] ، من المعروف أن نقص ألبومين الدم يسبب عدم اليقين في تفسير AG (2 ، 9-11) إذا تم تعديل AG لتركيز الألبومين غير الطبيعي (12 ، 13) ، يجب أن تتحسن فائدته (14). مع نهج BE (3) ، لا يتم التمييز بين النقص / الزيادة في الأحماض غير المتطايرة الضعيفة أو القوية (11) وبالتالي ، فإن التأثير القلوي لنقص ألبومين الدم (= عجز حمض ضعيف غير متطاير) قد يقابل ويخفي فائضًا من الأحماض غير المقاسة الأنيونات (مثل أحماض اللاكتات أو الكيتو).

نقدم نظامًا ثالثًا لتقييم جميع الأسباب الأولية للتشوهات الحمضية القاعدية في البلازما (7 ، 15 ، 16). يطبق نهج ستيوارت في الكيمياء الحمضية القاعدية (17) ويستند إلى نموذج رياضي للبلازما تم التحقق من صحته بالتجارب في المختبر (6 ، 7) تم توضيحه في M ethods ووصف بالتفصيل في مكان آخر (15). باستخدام البيانات السريرية من المرضى المصابين بأمراض خطيرة ، قمنا بمقارنة الأساليب التشخيصية الثلاثة لقدرتها على اكتشاف وتوصيف وقياس الشذوذ المعقد من الأحماض الأيضية في مثل هؤلاء المرضى.

تمت الموافقة على الدراسة من قبل لجنة المنح التابعة لوزارة الصحة ، جمهورية التشيك. تم سحب عينات الدم الشرياني من تسعة أشخاص أصحاء في حالة ما بعد الأكل (5 ذكور ، 4 إناث ، تتراوح أعمارهم بين 20 و 25 عامًا) أعطوا جميعًا موافقة خطية مستنيرة. بيانات المريض عبارة عن قياسات فردية في 152 مريضًا في وحدة العناية المركزة (ICU) في مستشفى الكلية بولوفكا في براغ (37٪ مصابين بصدمة ، بما في ذلك الصدمات الدماغية الدماغية 20٪ مع متلازمة الضائقة التنفسية الحادة [ARDS] والحالات ذات الصلة ، معظمهم تهوية ميكانيكية بنسبة 18٪ مع فشل القلب والأوعية الدموية ، بما في ذلك احتشاء عضلة القلب الحاد والإنعاش القلبي الرئوي 16٪ مع مضاعفات ما بعد الجراحة ، بما في ذلك الإنتان والفشل الكلوي ومتعدد الأعضاء 9٪ مع اضطرابات التمثيل الغذائي ، بما في ذلك الحماض الكيتوني السكري والتسمم). تم قياس غازات الدم الشرياني والكهارل والبروتينات في نفس عينة الدم. البيانات الأولية هي جزء من قاعدة البيانات التي استخدمت لدراسة أخرى (12).

شارك الأس الهيدروجيني والفوسفور 2 تم قياسها باستخدام محلل غازات الدم ABL300 (مقياس إشعاع) أو باستخدام محلل AVL 990. تم تحليل عينات البلازما المنفصلة لـ Na و K (مقياس الضوء باللهب FLM3 ، مقياس الإشعاع) ، Ca و Mg (مقياس طيف الامتصاص الذري AAS2 ، زايس) ، Cl- (معايرة الكلوريد CMT10 ، مقياس الإشعاع) ، الفوسفات غير العضوي مع الموليبدات ، البروتين الكلي مع البيوريت ، وألبومين المصل مع قياسات ضوئية أرجوانية برومكريزيل.

من الأس الهيدروجيني المقاس و P co 2 حسبنا [HCO3 -] باستخدام معادلة Henderson-Hasselbalch ، و BE مع صيغ Siggaard-Andersen لـ BE في البلازما وفي السائل خارج الخلية (18). تم حساب فجوة الأنيون على النحو التالي ([Na +] + [K +]) - ([Cl -] + [HCO3 -]) ، وتعديلها لتأثير تركيز الألبومين غير الطبيعي بالصيغة: AGمعدلة (ملي مكافئ لكل لتر) = AGملاحظ + 0.25 × ([الزلال الطبيعي] - [الزلال الملحوظ]) (بالجرام لكل لتر) (12 ، 13).

يتم تحديد الحالة الحمضية القاعدية في سائل الجسم فيزيائيًا من خلال عدة "متغيرات مستقلة" (المتغيرات التي يمكن أن تتغير بشكل أساسي ومستقل عن بعضها البعض). في بلازما الدم في الجسم الحيالمتغيرات المستقلة هي: (1) شركة ف 2 (2) "فرق الأيونات القوي" (SID) ، أي الفرق بين مجموع جميع الكاتيونات القوية (المنفصلة تمامًا وغير المتفاعلة كيميائيًا) (Na + ، K + ، Ca 2+ ، Mg 2+) وجميع الأنيونات القوية (Cl - والأنيونات القوية الأخرى) و (3) تراكيز الأحماض الضعيفة غير المتطايرة (أي مجموع أشكالها المنفصلة وغير المنفصلة لكل منها ، رمز ستيوارت أتوت). يتم الحصول على حالة القاعدة الحمضية الطبيعية عندما يكون للمتغيرات المستقلة قيم طبيعية (مثبتة تجريبياً). الشذوذ في واحد أو أكثر من المتغيرات المستقلة هو الأساس لجميع الاضطرابات الحمضية القاعدية. تعديل المتغيرات المستقلة هو جوهر جميع التدخلات العلاجية ، لأنه لا يوجد أي من "المتغيرات التابعة" (على سبيل المثال ، pH ، BE ، [HCO3 -]) يمكن تغييرها بشكل أساسي أو فردي: تتغير المتغيرات التابعة ، وكلها في وقت واحد ، وفقط إذا تغير واحد أو أكثر من المتغيرات المستقلة.

يظهر تصنيف للاضطرابات الحمضية والقاعدية على أساس هذا النهج في الجدول 1. في هذا الرأي ، يمكن أن تحدث الاضطرابات الأيضية الحمضية القاعدية عن طريق نوعين من التشوهات ، نناقشها لاحقًا: SID غير الطبيعي والتركيزات غير الطبيعية للأحماض الضعيفة غير المتطايرة.

الجدول 1. تصنيف الأحماض الأولية - الاضطرابات القاعدية

تعريف الاختصارات: [Alb] = تركيز ألبومين المصل [Pi] = تركيز الفوسفات غير العضوي SID = فرق أيوني قوي (Σ [الكاتيونات القوية] - Σ [الأنيونات القوية]) [XA -] = تركيز الأنيونات القوية غير المحددة.

* الحماض المخفف والقلاء التركيزي: عندما يكون هناك نقص أو فائض من الماء في البلازما (بمعيار غير طبيعي [Na +]) ، تتركز الكاتيونات والأنيونات القوية أو تخفف بالتساوي وهذا يزيد أو يقلل من SID بنفس الدرجة: إذا كان C - A = D ، إذن لا يجب الخلط بين القلاء المركّز والحماض المخفف على النحو المستخدم هنا وبين "قلوة الانكماش" و "الحماض المخفف" (19). تم استخدام المصطلحات الأخيرة للإشارة إلى التأثيرات الحمضية القاعدية المفترضة للنقص والزيادة في حجم السائل خارج الخلية ، على التوالي. ومع ذلك ، لا تغير التغييرات في الحجم ، في حد ذاتها ، أي من المتغيرات التي تحدد الحالة الحمضية القاعدية. إذا تم توسيع الحجم خارج الخلية عن طريق ضخ محلول ملحي كلوريد الصوديوم ، ينتج عن الحماض المفرط الكلور (20 ، 21).

† حماض مفرط الكلور والقلاء ناقص كلور الدم.

‡ تشمل الأحماض العضوية (اللاكتات وأحماض الكيتو في "الحماض الأيضي" المعنى الصارم فورمات أو الساليسيلات في حالات التسمم) ، والكبريتات والأنيونات الأخرى في الفشل الكلوي المزمن (قيم pK لجميع هذه الأحماض العضوية أقل بثلاث مرات على الأقل من درجة الحموضة في البلازما المتوافقة مع الحياة ، لذلك فهي دائمًا & gt 99.9٪ منفصلة في يمكن تضمين البلازما وأنيوناتها في تعريف SID) على عكس "فجوة الأنيون" ، لا تتضمن [XA] الفوسفات غير العضوي (الذي يتم تقييمه هنا بشكل منفصل ومباشر ، كأحد الأحماض الضعيفة غير المتطايرة).

§ مكون الحماض في فقدان الحجم الشديد خارج الخلية ، كما هو الحال في الكوليرا (22).

‖ مصدر القلاء هذا غير مهم سريريًا: القيمة الطبيعية لـ [Pi] (1 مللي مول / لتر) لا يمكن أن تنخفض بدرجة كافية ليكون لها تأثير حمضي قاعدي ملموس. مقتبس من (15).

أما بالنسبة لـ SID ، فيمكن أن تتغير قيمته بطريقتين عامتين: أولاً ، من خلال زيادة أو نقص الماء في البلازما ، حيث يتم تخفيف أو تركيز الكاتيونات القوية والأنيونات القوية بشكل متساوٍ (الحماض المخفف والقلاء التركيزي) ، يتم الكشف عنها عن طريق غير طبيعي. [+ Na] والثاني ، عن طريق تغيير التركيز الكلي للأنيونات القوية فقط (هذا صحيح لأن تركيزات الكاتيونات القوية بخلاف Na + يتم تنظيمها في السوائل خارج الخلية ضمن حدود ضيقة ، لأغراض لا تتعلق بالتوازن الحمضي القاعدي أو الأسمولية) .

هناك نوعان من المواد التي تعمل كأحماض ضعيفة غير متطايرة ولها تركيزات في البلازما كبيرة بما يكفي بحيث يمكن للتغييرات فيها أن تؤدي إلى اضطرابات قاعدية حمضية كبيرة: الفوسفات غير العضوي ([Pi] ، مليمول لكل لتر أو ملليغرام لكل ديسيلتر) وألبومين المصل ([ Alb] ، جرام لكل لتر).

يمكن للمرء أن يرى من الجدول 1 أن التغييرات في هذه الكميات الثلاثة المتغيرة بشكل مستقل [Alb] و [Pi] و SID يمكن أن يكون لها تأثيرات مضافة أو معادلة على توازن الحمض الأيضي - القاعدي. قد ينتج عن تأثيرات الموازنة هذه القيم الطبيعية للمتغيرات التابعة [HCO3 -] و BE ، بينما بعض المتغيرات المستقلة غير طبيعية. مثل هذه الحالة لا تعتبر حالة طبيعية حمضية قاعدية. يختلف هذا عن النهج التشخيصي المستند إلى BE هناك والشرط BE = 0 (أي ، الرقم الهيدروجيني = 7.40 عند P co 2 = 40 مم زئبق) ، بحكم التعريف ، الحالة الحمضية القاعدية العادية ، مهما كانت قيم المتغيرات المستقلة SID و Aتوت هم (14 ارى الملحق الموجود في مستودع الويب الخاص بـ مجلة).

يمكن تقييم كميات [Alb] (جرام لكل لتر) و [Pi] (مليمول لكل لتر) مباشرةً من تحليلات المصل المتاحة بشكل روتيني. يمكن اشتقاق المعلومات اللازمة لتقييم SID والأنيونات القوية بخلاف Cl - ([XA -] في الجدول 1) على غرار الأسطر التالية.

يوضح الشكل 1 كيف يتبع متطلبات الحياد الإلكتروني أن SID في البلازما يمكن اشتقاقه كمجموع [HCO3 -] بالإضافة إلى الشحنات الكهربائية السالبة التي يساهم بها الألبومين ([Alb -]) والفوسفات غير العضوي ([Pi -]) (7 ، 15 ، 23):

SID = [HCO 3 -] + [ألب -] + [Pi -] المعادلة 1

الشكل 1. الحياد الكهربائي في بلازما الدم: مجموع الشحنات الموجبة يساوي مجموع الشحنات السالبة ، كما يتضح من ارتفاعات متساوية للأعمدة التي تمثل الكاتيونات والأنيونات. تم حذف الأيونات التي تحتوي على تركيزات ميكرومولار أو نانومولار في البلازما (على أنها غير ذات أهمية على المقياس الموضح) (OH - ، CO3 2− و H +). Alb - و Pi - شحنة كهربائية سالبة يعرضها ألبومين المصل والفوسفات غير العضوي ، على التوالي. XA - = الأنيونات القوية غير المحددة SID = فرق أيوني قوي.

لهذا ، [HCO3 -] متاح من قياسات غازات الدم الشرياني ، و [-] و [Pi -] (ملي مكافئ لكل لتر) يتم حسابها من [ألب] (جرام لكل لتر) ، [Pi] (ملي مول لكل لتر) ، ودرجة الحموضة (5،7 الملحق ب):

[Alb -] = [Alb] × (0.123 × pH - 0.631) المعادلة 2 أ
[Pi -] = [Pi] × (0.309 × pH - 0.469) المعادلة 2 ب

(بالنسبة للتحديدات السريرية لتقديرات SID الأبسط تكون مرضية ارى مناقشة ).

"الأنيونات القوية غير المحددة" (XA - في الشكل 1) هي الأنيونات القوية بخلاف Cl - (اللاكتات وأحماض الكيتو والأنيونات العضوية الأخرى والكبريتات) في حالات مرضية معينة ، تزداد تركيزاتها (ارى الجدول 1). لا يمكن قياس إجمالي [XA -] بشكل مباشر في البلازما يوضح الشكل 1 أنه يمكن اشتقاقها على النحو التالي:

[XA -] = ([Na +] + [K +] + [Ca 2 +] + [Mg 2 +]) - [Cl -] - SID المعادلة 3

تم الكشف عن زيادة / نقص الماء على أنه غير طبيعي [+ Na] (الجدول 1). لتقدير وتحديد كمية Cl - فائض أو عجز عند وجود شذوذ في ماء البلازما ، يجب تصحيح [Cl -] المرصود للتخفيف / التركيز الناتج. يمكن القيام بذلك بضرب [Cl -] المرصود بعامل تصحيح ، على سبيل المثال:

[Cl -] مصححة = [Cl -] ملحوظة × ([Na +] عادي / [Na +] ملاحظ) ، المعادلة 4

والكلوريد الزائد / النقص (مليمول لكل لتر) ≈ [Cl -]عادي - [Cl -]تصحيح. تنطبق اعتبارات مماثلة على تقييم [XA -].

إذا كانت [Alb] و [Pi] و SID مع [XA -] و [Cl -] و [Na +] معروفة ، فإن جميع المعلومات اللازمة للتفسير الفيزيولوجي المرضي المفصل لبيانات قاعدة الحمض الأيضي تكون متاحة (الجدول 1).

يوضح الجدول 2 المقايسة وبعض المتغيرات المشتقة الحمضية القاعدية. في الأشخاص العاديين ، الكميات المقاسة وكذلك الكميات المشتقة العرفية BE ، [HCO3 -] ، وكانت فجوة الأنيون ضمن نطاق القيم الطبيعية المحددة (2 ، 3 ، 24). كان SID 39 ± 1 و [XA -] 8 ± 2 (mEq / L يعني ± SD).

الجدول 2. المتغيرات الحمضية القاعدية في بلازما الدم الشرياني

تعريف الاختصارات: اي جيمعدلة = فجوة الأنيون المعدلة لتركيز الألبومين غير الطبيعي = AGملاحظ + 0.25 × ([الزلال الطبيعي] - [الزلال الملحوظ]) (12) AGملاحظ = فجوة الأنيون المرصودة = ([Na +] + [K +]) - ([Cl -] + [HCO3 -]) BE = الزيادة القاعدية / النقص في البلازما أو السوائل خارج الخلية (18) Pi = الفوسفات غير العضوي (mg / dL = 3.09 mmol / L) SID = فرق الأيونات القوي (ارى الطرق ، المعادلة 1) TP = إجمالي بروتينات البلازما [XA -] = تركيز الأنيونات القوية غير المحددة (المعادلة 3).

§ مصححة لزيادة / نقص المياه (المعادلة 4). SID = [HCO3 -] + [Alb x−] + [Pi y−].

في المرضى ، يشير الرقم الهيدروجيني إلى حموضة الدم الشديدة إلى القلويات الواضحة ، نتيجة شذوذ الجهاز التنفسي أو التمثيل الغذائي. حامض الأيض - شذوذ القاعدة المعترف بها من خلال مناهج التشخيص التقليدية - BE أو [HCO3 -] مع AG - تباينت على نطاق واسع في الحجم. كان نقص ألبومين الدم ([Alb] 3 SD أقل من المتوسط ​​الطبيعي) موجودًا في 96 ٪ من المرضى. التصنيف المقترح هنا في الجدول 1 وسابقًا (15) سيحدد ويحدد التشوهات الأيضية المختلفة القلوية والتحمضية. من بين الانحرافات القلوية عن الطبيعي نقص ألبومين الدم (أدنى ملاحظة [ألب] 4 جم / لتر) ، ونقص فوسفات الدم (أدنى [Pi] 0.2 ملي مول / لتر أو 0.6 مجم / ديسيلتر) ، وزيادة SID (أعلى 47 ميلي مكافئ / لتر). الانحرافات غير التنفسية المحمضة هي فرط فوسفات الدم (أعلى [Pi] 3.4 مللي مول / لتر أو 10.5 ملليجرام / ديسيلتر) ، وانخفاض SID (أقل 18 مللي مكافئ / لتر). من بين العيوب التي تغير قيمة SID تم العثور على ما يلي: (1) شذوذ في محتوى الماء في البلازما ، مما ينتج عنه حماض مخفف (أدنى [Na] 117 مللي مكافئ / لتر) أو قلاء تركيز (أعلى [Na +] 159 مللي مكافئ / لتر) (2) غير طبيعي [Cl -] ، ينتج عنه قلاء ناقص كلور الدم (أدنى [Cl -]تصحيح 90 ملي مكافئ / لتر) أو الحماض المفرط الكلور (أعلى [-]تصحيح 123 ملي مكافئ / لتر) (3) وجود فائض "الأنيونات القوية بخلاف Cl -": الأعلى [XA -]تصحيح 37 ملي مكافئ / لتر (مصحح لزيادة / نقص الماء في البلازما ، المعادلة 4).

الأمثلة الفعلية لتشوهات حمض الأيض والقاعدة المكتشفة بهذا النهج ، بعضها معقد ، موضحة في الجدول 3 (ارى الجدول 2 للقيم العادية المرجعية للمتغيرات). في المريض 18 (مرض الانسداد الرئوي المزمن [COPD] ، الالتهاب الرئوي القصبي ، قصور القلب الاحتقاني) ، يعتبر نقص ألبومين الدم هو المصدر الوحيد للقلاء الاستقلابي الحاد. تشير الأساليب التقليدية إلى [HCO3 -] و BE +9 mEq / L ، ومع ذلك ، فإن SID و [Na +] و [Cl -] و [XA -] كلها طبيعية (كما هو الحال مع AGمعدلة). هذه حالة من قلاء ألبومين الدم البسيط. في المريض 59 (فشل أعضاء متعددة بعد الجراحة) ، يتم تقليل SID بمقدار 20 مللي مكافئ / لتر ، والذي ينتج عن مزيج من فائض ماء البلازما ([Na +] = 117 مللي مكافئ / لتر) ، زيادة الكلوريد (يتم تقديرها فقط باستخدام [Cl -]تصحيح) ، وبزيادة [XA -] نقص ألبومين الدم القلوي يخفف من حماض SID: BEرر، الذي يُزعم أنه مقياس للتغير في SID البلازمي (25 ، 26) ، هو - 10 مللي مكافئ / لتر ، أي أنه يكتشف نصف التغيير في SID فقط. اي جيملاحظ منخفض طبيعي (لكن الأنيونات غير الطبيعية تظهر بالارتفاع [XA -].)

الجدول 3. أمثلة على الاضطرابات المعقدة حمض - القاعدة

تعريف الاختصارات: اي جيملاحظ و AGمعدلة = فجوة الأنيون تمت ملاحظتها وتعديلها - الألبومين غير الطبيعي ، على التوالي BEرر و BEecf = الزيادة القاعدية في البلازما وفي السائل خارج الخلوي ، على التوالي (18) Cl - تصحيح و XA - تصحيح = كلوريد وأنيونات غير محددة ، مصححة لزيادة / نقص الماء ، على التوالي Pi = فوسفات غير عضوي.

في المريض 63 (السكتة القلبية ، والإنعاش القلبي الرئوي ، والتهاب الدماغ بنقص التأكسج) ، ينتج تقليل SID بمقدار ∼ 10 مللي مكافئ / لتر عن التأثيرات الموازنة لارتفاع [XA -] (خفض SID) ، ونقص الماء في البلازما ([Na + = 159 مللي مكافئ / L ، زيادة SID). يتم إخفاء الحماض الناتج عن انخفاض SID عن طريق قلوية نقص ألبومين الدم. يفتقد BE الحماض المرتفع [XA -] ويفسر الحالة الحمضية القاعدية على أنها قلاء استقلابي خفيف. [HCO3 -] مرتفع - طبيعي و AGملاحظ يفتقد ارتفاع الأنيونات الشاذة. لا يوجد فائض كبير في الكلوريد ، على الرغم من أن قياس [-] قد يوحي بذلك. ينتج قلوية الدم عن نقص حاد في الدم.

في المريض 81 (الصدمات المتعددة ، متلازمة الضائقة التنفسية الحادة ، الإنتان) ، يتم تقليل SID بمقدار ∼ 12 مللي مكافئ / لتر (بسبب فائض ماء البلازما ومرتفع جدًا [XA -]) و [Pi] مرتفع. يتم تخفيف هذه الحموضة عن طريق قلويات نقص الكلوريد ونقص ألبومين الدم: [HCO3 -] تم تخفيض AG بشكل طفيف فقطملاحظ هو ارتفاع عجز القاعدة فقط - 4 ملي مكافئ / لتر ، أي أن شدة الحماض يتم التقليل من شأنها إلى حد كبير.

في المريض 29 (الحماض الكيتوني السكري) ، يتم تقليل SID إلى 31 mEq / L ، بسبب التأثيرات الموازنة لارتفاع [XA -] مع فائض ماء البلازما (خفض SID) ، وعجز Cl (زيادة SID). يكاد يكون الحماض منخفض SID متوازنًا تمامًا عن طريق قلاء نقص ألبومين الدم ، بحيث يكون BE و [HCO3 -] ضمن الحدود العادية AGملاحظ مرتفع طبيعي. كلا النهجين التشخيصيين التقليديين يخطئان الحماض المرتفع [XA -] ويفسران البيانات على أنها قلاء تنفسي بسيط ، مع عدم وجود شذوذ في التمثيل الغذائي.

في المريض 51 (صدمة في الرأس ، غيبوبة ، فشل كلوي حاد) ، يتم تقليل SID بمقدار ∼ 10 مللي مكافئ / لتر. يحدث هذا بسبب زيادة [XA -] وزيادة الماء في البلازما ([Na +] = 133 مللي مكافئ / لتر). لا يوجد عجز في الكلوريد ، على الرغم من أن قياس [Cl -] قد يوحي بذلك. تتم موازنة الحماض منخفض SID بواسطة قلاء ألبومين الدم ، بحيث يكون كل من BE و [HCO3 -] مع AGملاحظ تبدو طبيعية. يفتقد BE إلى [XA -] المرتفع ويفسر البيانات على أنها حماض تنفسي بسيط ، مع عدم وجود اضطرابات أيضية.

في المريض 88 (فشل العديد من الأعضاء بعد الجراحة) ، ينخفض ​​SID بمقدار 13 مللي مكافئ / لتر بسبب الارتفاع الشديد [XA -]. يتطابق هذا الحماض تمامًا مع نقص ألبومين الدم القلوي ، بحيث يكون كل من BE و [HCO3 -] (و AGملاحظ) ضمن الحدود الطبيعية ، يتم فقدان الحماض الأيضي الشديد. ومع ذلك ، في جميع العينات التي تم فيها ارتفاع [XA -] أو [Pi] ، فإن ضبط AG لنقص ألبومين الدم (12) - كما هو متوقع - سمح باكتشاف هذا الشذوذ.

في المريض 41 (صدمة متعددة) ، يتم تقليل SID إلى 32 ملي مكافئ / لتر بواسطة الكلوريد الزائد. يتطابق الحماض المفرط الكلور تمامًا مع قلاء نقص ألبومين الدم ، بحيث يكون كل من BE و [HCO3 -] طبيعية.

في المريض 53 (تليف الكبد ، دوالي النزيف) ، يتم تقليل SID بمقدار 10 مللي مكافئ / لتر ، نتيجة زيادة ماء البلازما ([Na +] = 125 مللي مكافئ / لتر) و Cl - (تم تقدير الأخير فقط مع [ Cl -]تصحيح). هذا الحماض المختلط منخفض SID يتوافق تمامًا مع قلاء نقص ألبومين الدم. BE و [HCO3 -] طبيعي كلا النهجين التشخيصيين التقليديين يغيب عن هذا الحماض الأيضي المختلط.

في الجدول 4 ، اخترنا هؤلاء المرضى الذين كانت قيم BE و [HCO3 -] كانت ضمن نطاق قيمها الطبيعية (ضمن ± 2 SD من التحكم في الجدول 2). في هذه العينات ذات المؤشرات العرفية الطبيعية على ما يبدو للحالة الأيضية - القاعدية ، كشف النهج الموضح في الجدول 1 عن شذوذات ذات تواتر مفاجئ ، بعضها شديد وخطير. تأثير التحميض لـ SID المنخفض (موجود في 95٪ من هذه العينات مع BE و [HCO3 -] ، والناجمة عن زيادة Cl - أو XA - ، أو عن طريق تخفيف البلازما) تم تعويضها وبالتالي تم إخفاؤها بواسطة التأثير القلوي لنقص ألبومين الدم (لوحظ في 100 ٪ من هذه العينات التي تبدو طبيعية). قلاء نقص كلوريد الدم (موجود في 40٪ و 32٪ على التوالي) تم تعويضه بارتفاع [XA -] ، أو بحمض مخفف أو مفرط فوسفات الدم. في 14٪ من العينات مع [HCO3 -] ، تم رفع فجوة الأنيون الملحوظة (⩾ 3 SD فوق المتوسط ​​الطبيعي) مما أدى إلى تعديل فجوة الأنيون لنقص ألبومين الدم (12) مما أدى إلى زيادة اكتشاف "الأنيونات الفجوة" غير الطبيعية بأربعة أضعاف.

الجدول 4. الاضطرابات الأيضية الحمضية - الأساسية الخفية في المرضى الذين يعانون من زيادة عادية * في القاعدة أو تركيز ثنائي كربونات البلازما

تعريف الاختصارات: اي جيمعدلة (ملي مكافئ لكل لتر) = فجوة الأنيون المعدلة لتركيز الألبومين غير الطبيعي = AGملاحظ + 0.25 × ([الألبومين الطبيعي] - [الزلال الملحوظ]) (جرام لكل لتر) (12) AGملاحظ = فجوة الأنيون المرصودة = ([Na +] + [K +]) - ([Cl -] + [HCO3 +]) [Pi] = تركيز الفوسفات غير العضوي SID = فرق أيوني قوي (ارى الطرق ، المعادلة 1) [XA -] = تركيز الأنيونات القوية غير المقاسة (المعادلة 3).

* ضمن ± 2 SD من متوسط ​​قيمة التحكم (ارى الجدول 2).

زيادة / عجز أساسي للسائل خارج الخلية (15).

‡ ⩽ 3 SD أقل من متوسط ​​الضوابط (ارى الجدول 2).

§ ⩾ 3 SD فوق متوسط ​​الضوابط.

‖ مصححة لزيادة / عجز المياه (المعادلة 4).

** البيانات بين قوسين هي القيم القصوى في المجموعات.

يمكن تفسير جميع الاضطرابات الحمضية والقاعدية الظاهرة هنا بسهولة ، وتقييمها بشكل مباشر وكمي ، على أنها شذوذ في المتغيرات المستقلة. 2و [ألب] و [باي] و SID. البيانات المطلوبة لمثل هذا التقييم الشامل (P co 2 و pH ، [Alb] ، [Pi] ، وتركيزات الإلكتروليتات Na + ، K + ، Ca 2+ ، Mg 2+ ، Cl -) متوفرة من قياسات غازات الدم وملامح كيمياء المصل.

على الرغم من أن تحديد [Mg 2+] غير مدرج في ملفات تعريف الكيمياء الروتينية ، فإن تغييراته عادة ما تكون صغيرة جدًا بحيث يمكن إهمالها ويمكن افتراض قيمة ثابتة لـ [Mg 2+] في حساب [XA -] (المعادلة 3). في بياناتنا من المرضى المصابين بأمراض شديدة ، تفاوت [Mg 2+] من 0.8 إلى 2.6 mEq / L عندما تم استبدال [Mg 2+] المقاس بثابت 1.7 ، وكان التأثير على القيم المحسوبة لـ [XA -] ضئيلًا : كان متوسط ​​الفرق 0.1 mEq / L (± 0.3 ، مدى SD −0.9 إلى +0.9 mEq / L). لا ينطبق هذا التبسيط إذا تم إعطاء جرعات كبيرة من أملاح Mg عن طريق الحقن (على سبيل المثال ، في علاج تسمم الحمل) (25). لتقييم البيانات بجانب السرير ، يمكن أيضًا تبسيط صيغة SID (المعادلات 1 و 2 أ و 2 ب) إلى

SID ≈ [HCO 3 -] + 0.28 × [ألب] (جم / لتر) + 1.8 × [Pi] (مليمول / لتر) المعادلة 5

العاملان 0.28 و 1.8 عبارة عن شحنة كهربائية سالبة (بالملي تكافؤ) معروضة بمقدار 1 جرام من الألبومين و 1 ملي مول من الفوسفات ، على التوالي ، في البلازما عند الرقم الهيدروجيني = 7.40 (7) إذا كانت وحدات [Pi] ملليغرام لكل ديسيلتر ، فإن العامل لـ [Pi -] تساوي 0.6. تباين هذه العوامل مع الرقم الهيدروجيني الفعلي أو مع الارتباط الأيوني لا يكاد يذكر لغرض هذه الحسابات. كان الاتفاق بين قيم SID المحسوبة بالمعادلات 1 و 2 أ و 2 ب ، وتلك المقدرة بالمعادلة 5 مرضية في بياناتنا: كان الفرق المتوسط ​​0.0 ± 0.2 مللي مكافئ / لتر (± مدى SD - 1.2 إلى +0.8 مللي مكافئ / لتر) .

في الحالات السريرية غير المعقدة ، تعتمد الأساليب المعتادة على BE ، أو على [HCO3 -] تكملة مع فجوة الأنيون ، قد تكون مرضية. ومع ذلك ، في الاضطرابات المعقدة للمرضى المصابين بأمراض خطيرة ، قد توجد اضطرابات قلوية وتحميضية على حد سواء ، فقد يفلتوا من الكشف بسبب آثارهم التعويضية على المؤشرات المعتادة لحالة القاعدة الحمضية الأيضية (الجدولان 3 و 4).

مع [HCO3 -] نهج حساب AGملاحظ يجب أن تشير إلى أن الوضع الطبيعي الظاهر في القياسات مع [HCO3 -] كان خاطئًا ، لكن هذا كان سيساعد فقط اثنين من 13 مريضًا مصابين بحمض خفي من [XA -] أو [Pi] مرتفع ، أو كليهما. عندما تم تعديل AG لمراعاة تأثيرات نقص ألبومين الدم (12) ، كما هو متوقع ، تم رفعه في جميع العينات مع الوضع الطبيعي [HCO3 -] التي رفعت [XA -] و [Pi].

كن مفقودًا في الاضطرابات الحامضية القاعدية المهمة في الاضطرابات المعقدة لدى مرضانا. من بين 20 مريضًا لديهم BE طبيعي (الجدول 4) ، كان لدى 19 مريضًا قيم SID منخفضة جدًا. نتجت هذه التشوهات الحمضية عن زيادة [XA -] ، أو تخفيف البلازما ، أو فرط كلور الدم (أو مجموعاتهما). لم يتم اكتشاف هذا بواسطة BE لأن الحماض منخفض SID كان محجوبًا بالتأثير القلوي لنقص ألبومين الدم ، الموجود في جميع هؤلاء المرضى. فيما يلي أسباب فشل BE في الكشف عن الحماض الاستقلابي في وجود نقص ألبومين الدم.

يُزعم أن يكون BE مساويًا لانحراف SID عن قيمته الطبيعية (26 ، 27). ومع ذلك ، هذا صحيح فقط إذا كانت تركيزات البلازما من المحاليل غير الكربونية (الألبومين والفوسفات) طبيعية.عندما لا يتم استيفاء هذا الشرط ، يجب تعديل الحالة المرجعية لـ "SID العادي" (14 أنظر أيضا الملحق في الملحق عبر الإنترنت لهذه المقالة). هذا ما تفعله طريقة BE بالفعل (3 ، 26): بالنسبة لحالة BE = 0 ، عند وجود نقص ألبومين الدم ، يعتبر SID المعدل طبيعيًا ، يجب أن يكون أقل مما يحصل عندما يكون تركيز ألبومين المصل طبيعيًا ، لإرضائه حالة الرقم الهيدروجيني = 7.40 عند P co 2 = 40 مم زئبق ، وهو التعريف الوحيد لـ BE = 0 تغييرات في تركيز الألبومين لا تعتبر شذوذًا في القاعدة الحمضية (26). ومع ذلك ، قد ينتج هذا المعدل (المنخفض) من SID عن ثلاث آليات مختلفة: فرط كلور الدم ، أو ارتفاع [XA -] ، أو تخفيف البلازما (ارى الجدول 1). * يدعي ويلكس (28) أنه مع نقص ألبومين الدم ينخفض ​​SID عن طريق زيادة البلازما [Cl -] ، عن طريق التعويض الكلوي لنقص ألبومين الدم ، استنتاجه يستند إلى 223 قياسًا لمتغيرات القاعدة الحمضية في 91 مريضًا في وحدة العناية المركزة. في قياساتنا الفردية للمرضى المصابين بأمراض خطيرة ، لم نجد أي ارتباط بين تركيز الألبومين في الدم و [Cl -]ملاحظ أو [Cl -]تصحيح. هذا ليس مفاجئًا ، لأنه في معظم مرضى وحدة العناية المركزة ، تعمل العديد من التدخلات الروتينية على تغيير البلازما [-] إلى درجة يمكن أن تطغى على نطاق تنظيم هذا الأنيون عن طريق الكلى (على سبيل المثال ، مدرات البول ، والشفط الأنفي المعدي ، وعمليات نقل منتجات الدم ، فرط التغذية في الوريد ، ضخ كبير من محاليل كلوريد الصوديوم). من ناحية أخرى ، كان ارتفاع [XA -] (3 SD أعلى من متوسط ​​الأشخاص الضابطين) موجودًا في أكثر من نصف جميع مرضانا الذين يعانون من نقص ألبومين الدم ، وفي ثلث أولئك الذين يعانون من نقص ألبومين الدم الطبيعي (الجدول 4) .

في أربعة من 152 مريضًا ، كان [XA -] (المصحح لزيادة / نقص الماء) أقل من 4 مللي مكافئ / لتر (& gt 2 SD أقل من متوسط ​​بيانات التحكم). نظرًا لأن هذا غير محتمل ، يجب على المرء أن يشك في وجود بعض الكاتيونات غير المحددة في البلازما ، مثل البروتينات الكاتيونية (29) أو الأدوية الموجبة بتركيزات الميلي مولار (السامة) (30 ، 31). عند وجود مثل هذه الكاتيونات ، فإن قيمة [XA -] المحسوبة بالمعادلة 3 ليست مقياسًا صالحًا "لجميع الأنيونات القوية بخلاف Cl -." بدلاً من ذلك ، يحل لـ ([XA -] - كاتيونات غير محددة) ، أي أنه يقلل من القيمة الحقيقية لـ [XA -]. لحسن الحظ ، فإن التركيزات العالية من الكاتيونات غير المحددة نادرة ، حتى في إعدادات وحدة العناية المركزة وعند الاشتباه ، توجد طرق يمكن من خلالها التعرف عليها.

يمكن أن يتسبب نقص ألبومين الدم ، وهو شذوذ في كل مكان تقريبًا في المرضى المصابين بأمراض خطيرة ، في إرباك تفسير البيانات الحمضية القاعدية عندما تعتمد أساليب التشخيص المعتادة على BE أو البلازما [HCO3 -] مع AG.

فشل BE كمقياس للحماض الأيضي عندما يكون تركيز ألبومين المصل ، المخزن المؤقت الرئيسي غير البيكربونات في البلازما ، منخفضًا.

الطريقة التي تعتمد على البلازما [HCO3 -] و AGملاحظ يمكن أن يخطئ أو يقلل من "فجوة الحموضة" عندما يكون ألبومين المصل منخفضًا. ومع ذلك ، عند تعديله لتركيز الألبومين غير الطبيعي (12) ، يكون AG موثوقًا في الكشف عن مثل هذه الحمضية "الفجوة" المخفية. تم التشكيك مؤخرًا في فائدة هذا النهج (32).

الطريقة الثالثة لتحليل البيانات الحمضية القاعدية المقدمة هنا تسمح للفرد باكتشاف وتحديد جميع المكونات الفردية المختلفة حتى لأكثر الاضطرابات الحمضية والقاعدية تعقيدًا التي تُرى في المرضى المصابين بأمراض خطيرة. بالإضافة إلى ذلك ، فإنه يعطي نظرة ثاقبة في التسبب في الاضطرابات الأيضية الحمضية والقاعدية ، مما يوضح اختيار التدخلات العلاجية المحددة المناسبة. يمكن إجراء جميع الحسابات اللازمة لنظام التقييم المقترح بسهولة على السرير ، باستخدام آلة حاسبة بسيطة محمولة باليد. يفسح النظام نفسه لإجراء تقييم آلي شامل للبيانات الحمضية القاعدية المعقدة. يمكن الحصول على برنامج كمبيوتر بسيط لهذا من المؤلفين.

المؤلفون بالشكر الدكاترة. Zdena Krupková و Karel Zı́tko للمساعدة في استرداد بيانات المريض ، والدكتور D.E Leith للحصول على تعليقات مفيدة.


المواد والأساليب

حيوانات تجريبية

العينات البالغة من كلا الجنسين من الأسماك الرئوية الأفريقية بروتوبتروس أنيكتينز أوين (143 ± 6 جم يعني الكتلة ± sem ن= 46) من وسط إفريقيا إلى سنغافورة من خلال مزرعة أسماك محلية. ثم تم شحن Lungfish إلى أوتاوا عن طريق الشحن الجوي. أثناء العبور ، تم وضع الأسماك الرئوية في أكياس مملوءة جزئيًا من الماء المؤكسج في حاويات معزولة ، وعند وصولها ، تم نقل الأسماك إلى أحواض بلاستيكية مغطاة فردية مملوءة بـ 2-3 لتر من مياه الصنبور في مدينة أوتاوا منزوعة الكلور والتي تم تسخينها إلى 25 درجة مئوية. تم تغيير ماء الخزان في أيام بديلة أو قبل ذلك إذا حدث تلوث واضح للماء. تم الاحتفاظ بسمكة الرئة في غرفة تم فيها الحفاظ على درجة حرارة الهواء عند 25 درجة مئوية ، تحت فترة ضوئية اصطناعية من 10 ساعات: 14 ساعة فاتحة: داكنة. تم تغذية الأسماك في أيام بديلة بديدان الدم المجمدة أو قطع لحم تراوت قوس قزح ، وتم السماح لها بالتأقلم مع هذه الظروف لمدة شهر على الأقل قبل التجربة.

للسماح بأخذ عينات الدم بشكل دوري بالإضافة إلى التسريب الحمضي أو الأساسي ، تم إدخال قنية (أنابيب بولي إيثيلين كلاي آدمز PE50 VWR ، مونتريال ، QC ، كندا) في الشريان الأبهر الظهري لجميع الأسماك ، كما وصفه بيري وآخرون (بيري وآخرون. آل ، 2005). تم إجراء الجراحة على أسماك الرئة التي تم تخديرها أولاً عن طريق الغمر في محلول MS-222 (ethyl-ص-أمينوبنزوات 0.67 جم لتر -1) معدلة لدرجة الحموضة المحايدة باستخدام NaHCO3 تم الحفاظ على (1.3 جم لتر -1) التخدير أثناء الجراحة عن طريق لف السمكة في مناشف ورقية مبللة بمحلول التخدير. مجموعة فرعية من أسماك الرئة (ن= 7) بقسطرة بولية خارجية حسب إجراء Curtis and Wood (Curtis and Wood، 1991). يسمح استخدام القسطرة البولية الخارجية بتجميع البول حيث يتم تفريغه بشكل طبيعي من الحليمة البولية التناسلية. بعد الجراحة ، تمت إعادة أسماك الرئة إلى حاوياتها لمدة 24 ساعة. تم غسل الكانيولا يوميًا بمحلول كورتلاند الملحي (وولف ، 1963).

بروتوكول تجريبي

المجموعة 1. الجهاز التنفسي مقابل التعويض الأيضي لاضطرابات الحمض القاعدي

سمكة (ن= 19) التي تم تركيبها سابقًا بقنية الأبهر الظهرية في غرف قياس التنفس المخصصة قبل ساعتين تقريبًا من بدء التجربة. تمتلئ الغرف الأسطوانية بالماء (1 لتر) بصرف النظر عن مساحة الهواء القابلة للتعديل (60 مل كحد أقصى مضبوط بشكل نموذجي على 30 مل) عند أحد طرفي مقياس التنفس ، لوحظت أحجام الماء والهواء الدقيقة لكل سمكة. سرعان ما أدركت أسماك الرئة وجود المجال الجوي ، وعادةً ما تبدأ في استنشاق الهواء على فترات منتظمة ، متخذة موضعًا في مقياس التنفس حيث يكون رأسها أسفل المجال الجوي مباشرة. تم التقاط حدوث كل نفس للهواء بواسطة جهاز مصمم خصيصًا اكتشف الانقطاعات في حزمتين من الأشعة تحت الحمراء موجهة عبر سطح الماء. تم تزويد كلا المقصورتين بوسائط متدفقة باستمرار (ماء أو هواء مرطب ، عند 25 درجة مئوية) ما عدا أثناء قياسات معدلات O2 استهلاك(ا2) ، CO2 إفراز(كو2) ، وصافي إفراز الحمض في الماء. خلال هذه القياسات ، تمت إعادة تدوير الماء باستخدام مضخة تمعجية ، وتم إغلاق حجرة الهواء. الألياف البصرية O2 الأقطاب الكهربائية (Ocean Optics AL300 ، Dunedin ، FL ، USA) مختومة في غرفة الهواء وفي الأنبوب الذي تم من خلاله إعادة تدوير المياه لقياس الهواء والماء صا2 ، على التوالي. جوي صكوتم قياس 2 باستخدام CO2 قطب كهربائي (مستشعرات تحليلية E201 ، Sugarland ، TW ، الولايات المتحدة الأمريكية) يتم إدخاله في غرفة الهواء ، أثناء قياس المياه صكو2 ينطوي على استخدام مضخة تمعجية صغيرة لنقل المياه بعد ثاني أكسيد الكربون2 قطب كهربائي (مستشعرات تحليلية E201) موجود داخل كفيت منظم حراريًا (25 درجة مئوية) (مقياس إشعاع) قبل إعادته إلى مقياس التنفس. تم استخدام مقاييس التنفس هذه في دراسة سابقة (بيري وآخرون ، 2005) حيث تم تحديد مدى انتقال الغاز عبر السطح البيني بين الهواء والماء ووجد أنه لا يكاد يذكر.

بمجرد أن كانت الأسماك تتنفس الهواء على فترات منتظمة وكانت تفعل ذلك لمدة ساعة واحدة على الأقل ، فإن القياسات الأساسية ("السابقة") لـ ا2, كو2تم إجراء عدد مرات التهوية وصافي إفراز الحمض وحالة القاعدة الحمضية في الدم على مدار ساعة واحدة. تم إغلاق غرف الماء والهواء بعد إيقاف تدفق الوسائط ، وبدأت مضخة إعادة التدوير لتوفير الخلط. التغييرات في الهوائي صا2 و صكوتم رصد 2 لفترتين مدة كل منهما 30 دقيقة ، تم خلالها تحديث الهواء داخل الغرفة. التغييرات في المائية صا2 و صكوتم رصد 2 لمدة 30 دقيقة تقريبًا أو حتى معدلات ثابتة لثاني أكسيد الكربون2 تراكم و O2 تم تحقيق النضوب. بالإضافة إلى الكشف التلقائي عن أنفاس الهواء ، تم تحديد وتيرة تنفس الماء عن طريق العد البصري لأنفاس الماء على فترات دورية. لقياس صافي إفراز الحمض ، تم سحب 20 مل من عينات الماء في بداية ونهاية فترة التدفق من ساعة واحدة. تم سحب عينة دم 0.5 مل في نهاية فترة القياس. تم طرد عينة الدم وطرد البلازما للتحليل الفوري لدرجة الحموضة وإجمالي ثاني أكسيد الكربون2 المحتوى (CCO2). تم إعادة تعليق خلايا الدم الحمراء المتبقية في محلول Cortland الملحي بالهيبارين (50 وحدة دولية مل -1 أمونيوم هيبارين سيجما ، أوكفيل ، أونتاريو ، كندا) وأعيد حقنها في الأسماك. في نهاية فترة القياس هذه ، تمت إعادة مقياس التنفس إلى حالة التدفق وبدأ التسريب الحمضي أو الأساسي.

تم حقن سمك الرئة بالحمض (0.9 جزيء جرامي لتر -1 NH4Cl ن= 11) أو القاعدة (0.9 مول لتر -1 NaHCO3 ن= 8) بمعدل 3 مليمول كجم -1 ساعة -1 لمدة ساعة واحدة. تم استخدام مضخة حقنة (أدوات SAGE 355) لبث الحمض أو القاعدة عبر قنية الأبهر الظهرية. بمجرد بدء التسريب الحمضي أو القاعدي ، تم إغلاق غرف الماء والهواء وتكررت سلسلة القياسات الموصوفة أعلاه ، وبلغت ذروتها بسحب عينة الدم فورًا بعد فترة التسريب. تم سحب عينات الدم أيضًا في 3 و 6 و 18 ساعة بعد التسريب ، وسبقت في كل حالة بنفس سلسلة قياسات ا2, كو2وتردد التهوية وصافي إفراز الحمض. بعد سحب عينة الدم البالغة 18 ساعة ، تم تخدير السمكة الرئوية فى الموقع عن طريق الحقن داخل الشرايين بمقدار 400 مجم كجم -1 من بنتوباربيتال الصوديوم (سومنوتول) ، ثم يتم التضحية بها عن طريق الحقن داخل الشرايين بمادة KCl مشبعة. فترة قياس نهائية لـ ا2, كو2 وتم إجراء إفراز الحمض الصافي على مدى 45 دقيقة لتقدير المستويات الأساسية لنقل الغاز وصافي إفراز الحمض. تم افتراض أن هذه القيم الأساسية تعكس التمثيل الغذائي الجلدي (الذي قد يقللون من شأنه) و / أو التمثيل الغذائي الناشئ عن الكائنات الحية الدقيقة في الماء أو على سطح الأسماك (بيري وآخرون ، 2005). لكل سمكة ، قيم ا2, كو2 وتم تصحيح إفراز الحمض الصافي لعملية التمثيل الغذائي في الخلفية عن طريق طرح المعدلات المحددة في قياس التنفس / فترة التدفق النهائية.

المجموعة 2. تقسيم صافي إفراز الحمض بين الخياشيم / الجلد والكلى في الأسماك المغموسة في القاعدة

Lungfish (ن= 7) في غرف قياس التنفس المخصصة ولم تبدأ التجارب حتى حدثت ساعة واحدة على الأقل من تنفس الهواء على فترات منتظمة. تم تزويد الأسماك المستخدمة في هذه التجارب بقنية أبهرية ظهرية (لم يتم جمع عينات الدم للتسريب الأساسي في هذه التجارب) وقسطرة بولية خارجية. تم جمع البول بشكل مستمر طوال فترة التجربة عن طريق السماح للقسطرة البولية بالتصريف ، عن طريق الجاذبية ، في قنينة تقع خارج مقياس التنفس وتحتفظ بحوالي 5 سم تحت مستوى الماء. تم فحص القسطرة البولية للتأكد من عدم وجود تسرب وذلك برفع القسطرة 5 سم فوق مستوى الماء. في ظل هذه الظروف ، يشير انخفاض مستوى البول في القسطرة إلى حدوث تسرب ، وتم إنهاء التجربة. أولاً ، تم إجراء فترة تدفق لتحديد المستويات الأساسية ("السابقة") لإفراز الحمض الصافي في الماء والبول ، فضلاً عن معدل تدفق البول (UFR) ودرجة الحموضة و CCO2. توقف تدفق الماء إلى مقياس التنفس ، وأغلقت الحجرة وبدأت مضخة إعادة التدوير لتوفير الخلط. تم جمع عينات المياه (20 مل) في البداية وعند 3 ساعات من فترة التدفق 4 ساعات. لضمان إزالة حجم المساحة الميتة داخل القسطرة البولية ، تم التخلص من البول الذي تم جمعه خلال 60 دقيقة الأولي من فترة التدفق. في نهاية فترة التدفق ، تمت إعادة إنشاء تدفق المياه إلى مقياس التنفس وبدأ التسريب الأساسي. القاعدة (0.9 مول لتر -1 NaHCO3) في قنية الأبهر الظهرية ، باستخدام مضخة حقنة ، بمعدل 3 مليمول كجم -1 ساعة -1 لمدة ساعة واحدة. تم إجراء فترات التدفق على مدار الأربع ساعات الأولى بعد التسريب الأساسي ، ومن 17 إلى 21 ساعة بعد التسريب الأساسي.

السلسلة 3. تأثير التسريب الحمضي أو القاعدي على التعبير الجيني

بعد الشفاء من الجراحة ، تم حقن سمكة الرئة المزودة بقنية أبهرية ظهرية داخل الشرايين بمحلول ملحي (Cortland saline ، 0.5 مل h –1 ن= 3) ، حمض (0.9 مول لتر -1 NH4Cl ن= 8) أو القاعدة (0.9 مول لتر -1 NaHCO3 ن= 7) بمعدل 3 مليمول كجم -1 ساعة -1 لمدة ساعة واحدة باستخدام مضخة حقنة. تم التضحية بسمكة الرئة 4 ساعات (ن= 8) أو 8 ساعات (ن= 7) بعد فترة التسريب الحمضي أو القاعدي ، وتم جمع عينات أنسجة الخياشيم والكلى ، وتجميد الفلاش في السائل N2 ويتم تخزينها في درجة حرارة -80 درجة مئوية لتحليل التعبير الجيني لاحقًا. تم أخذ عينات من الأسماك المشبعة بالملح بعد 8 ساعات من فترة التسريب لتوفير بيانات التحكم.

أجراءات تحليلية

لقياس التنفس ، صكوتم توصيل قطبين كهربائيين بمحلل غازات الدم (Cameron Instruments BGM200 ، Port Aransas ، TX ، الولايات المتحدة الأمريكية) الذي تم تخصيصه لقبول ثاني أكسيد الكربون2 المدخلات. تم تحويل الإخراج من محلل غازات الدم وكاشف التنفس بالأشعة تحت الحمراء إلى بيانات رقمية وتخزينها عن طريق التفاعل مع نظام الحصول على البيانات (Biopac Systems Inc. ، Harvard Apparatus Canada ، Saint-Laurent ، QC ، كندا) باستخدام Acknowledge ™ الحصول على البيانات برنامج (معدل أخذ العينات مضبوط على 30 هرتز) وجهاز كمبيوتر. خرج من الألياف البصرية O2 تم جمع الأقطاب الكهربائية باستخدام برنامج Ocean Optics الذي يعمل على نفس الكمبيوتر الشخصي. تم تجميع هذه البيانات كملفات نصية لاستيرادها لاحقًا إلى برنامج جداول البيانات للتخزين والتحليل. لمعايرة الألياف البصرية O2 القطب المستخدم للمياه صا2 قياسات ، تم غمر القطب في محلول صفري (2 جم لتر -1 كبريتات الصوديوم) أو ماء مشبع بالهواء حتى تم تسجيل قراءات مستقرة. تقوم الألياف الضوئية O2 القطب المستخدم للهواء صاتمت معايرة قياسات 2 فى الموقع في مقياس التنفس عن طريق تدفق المرطب N2 الغاز (صفر) أو الهواء بشكل مستمر من خلال غرفة الهواء. كلا CO2 تم معايرة الأقطاب الكهربائية فى الموقع باستخدام مخاليط 0.5٪ و 1.0٪ CO2 في الهواء الذي تم توفيره بواسطة مقياس تدفق خلط الغاز (Cameron Instruments GF-3 / MP). تم استخدام مخاليط الغاز المرطب التي تتدفق عبر غرفة الهواء في جهاز التنفس لمعايرة الهواء صكو2 قطب كهربائي ، في حين تم استخدام الماء الذي تمت معايرته مع مخاليط الغاز وضخه عبر الكوفيت لمعايرة ثاني أكسيد الكربون2 القطب المستخدم للمياه صكو2 القياسات.

تم تحديد معدلات نقل الغاز الجوي من منحدرات العلاقات بين توترات الغاز المستوحاة والوقت ، خلال الفترة التي تم فيها إغلاق غرفة الهواء ، مع مراعاة حجم غرفة الهواء ، وكتلة الأسماك ، ومعاملات قابلية الذوبان لـ O2 وشارك2 في الهواء عند 25 درجة مئوية (Boutilier et al. ، 1984). وبالمثل ، تم حساب نقل الغاز المائي باستخدام منحدرات العلاقات بين توترات غاز الماء والوقت خلال الفترة الزمنية التي تم فيها إعادة تدوير الماء في مقياس التنفس ، مع مراعاة حجم غرفة الماء ، وكتلة الأسماك. بالنسبة لـ O2، تم الحصول على معامل الذوبان في الماء العذب عند 25 درجة مئوية من Boutilier et al. (Boutilier et al. ، 1984). لشركة CO2، تم تحديد معامل السعة في مدينة أوتاوا منزوعة الكلور في ماء الصنبور عند 25 درجة مئوية بشكل تجريبي ليكون 0.041 ميكرولتر لتر -1 مم زئبق -1 عن طريق قياس إجمالي ثاني أكسيد الكربون2 تمت معايرة تركيزات (Cameron Instruments Capni-Con 5) لعينات المياه إلى نطاق صكو2 قيم مصادفة في تجارب قياس التنفس.

تم طرد عينات الدم (10000 ز لمدة دقيقة واحدة) بعد الانسحاب مباشرة لإنتاج البلازما. إجمالي ثاني أكسيد الكربون في البلازما2تم تحديد التركيز في نسختين على 50 عينة ميكرولتر (Cameron Instruments Capni-Con 5). تم قياس الأس الهيدروجيني في البلازما باستخدام قطب الأس الهيدروجيني ومرجع الكالوميل (المستشعرات التحليلية E301 قطب الأس الهيدروجيني الزجاجي) التي تم وضعها في غرفة درجة حموضة منخفضة الحجم (أدوات كاميرون) ومتصلة بمحلل قاعدة حمضي PHM 72 (مقياس إشعاع) . الدم الشرياني صكو2 (صأكو2) وتركيز البيكربونات ([HCO- 3]) من معادلة Henderson-Hasselbalch باستخدام القيم المناسبة لـ αCO2 و pK ′ (Boutilier et al. ، 1984).

إفراز الحمض الصافي (يصافيتم تحديد H +) من قياسات صافي تدفق الحمض القابل للمعايرة (يصافيTA) والتغير في تركيز الأمونيا في عينات المياه التي تم جمعها في بداية ونهاية فترة التدفق. ماء يصافيتم تقييم TA وتركيز الأمونيا خلال 24 ساعة من جمع العينة وتم تجميد ما تبقى من عينة الماء لتحليل تركيزات الأيونات في وقت لاحق. يصافيتم تحديد TA عن طريق المعايرة (باستخدام ميكروبيور دقيق Gilmont) 5 مل من عينات الماء من بداية ونهاية كل فترة تدفق إلى الرقم الهيدروجيني 4.00 مع 0.02 مول لتر -1 حمض الهيدروكلوريك. تم تهوية العينات بشكل مستمر قبل وأثناء المعايرة لضمان خلط وإزالة ثاني أكسيد الكربون2. تم استخدام تعديل دقيق للمقايسة اللونية الساليسيلات - هيبوكلوريت لفردو وآخرون (Verdouw et al. ، 1978) لقياس مستويات الأمونيا الإجمالية في عينات المياه. يصافيثم تم حساب H + كمجموع يصافيTA وتدفق الأمونيا (يصافينيو هامبشاير3) ، العلامات التي تم النظر فيها ، كما وصفها ماكدونالد آند وود (ماكدونالد آند وود ، 1981).

تم تحديد صافي إفراز الحمض الكلوي أيضًا كمجموع صافي تدفق الحمض القابل للمعايرة وتدفق الأمونيا (Wood and Caldwell ، 1978). البولية يصافيتم قياس TA عن طريق خفض الرقم الهيدروجيني لقسمة 200 ميكرولتر من البول أقل من 5.0 من خلال إضافة حجم معروف قدره 0.02 مول لتر -1 حمض الهيدروكلوريك. ثم تم تهوية العينة لمدة 20 دقيقة لإزالة ثاني أكسيد الكربون2. أثناء الاستمرار في التهوية ، تمت معايرة الرقم الهيدروجيني لعينة البول مرة أخرى إلى الرقم الهيدروجيني للدم الممثل لفترة أخذ العينات المحددة من خلال إضافة 0.02 مول لتر -1 هيدروكسيد الصوديوم باستخدام ميكروبيور دقيق (Gilmont). يُعطى المكون القابل للمعايرة لصافي إفراز الحمض الكلوي بالاختلاف في كميات الحمض والقاعدة المضافة إلى البول. تم تحديد معدلات تدفق البول بطريقة الجاذبية. كما هو الحال مع عينات الماء ، البول يصافيتم تقييم TA وتركيز الأمونيا خلال 24 ساعة من جمع العينة مع درجة الحموضة في البول و CCO2. تركيز الأمونيا في البول ودرجة الحموضة وثاني أكسيد الكربون الكلي2 تم تقييم التركيز باستخدام الإجراءات الموصوفة أعلاه للمياه أو الدم. لحساب البول [HCO - 3] ، تم استخدام الثوابت المشتقة للمياه العذبة (Boutilier et al. ، 1984).

الاستنساخ الجزيئي وتحليل الأنهيدراز الكربوني لسمك الرئة ، Na + / HCO3 - الناقلات المشتركة و H + V-ATPase

إجراءات الاستنساخ

تم جمع أنسجة استنساخ أسماك الرئة CA و NBC و H + V-ATPase من الأسماك التي تم تخديرها نهائيًا عن طريق الغمر في محلول MS-222 (انظر أعلاه). تم عزل إجمالي الحمض النووي الريبي من نسيج معين باستخدام Trizol (Invitrogen ، Burlington ، ON ، كندا) وفقًا لتعليمات الشركة الصانعة. تم التحقق من كمية ونوعية الحمض النووي الريبي (RNA) عن طريق القياس الطيفي (Eppendorf BioPhotometer) و / أو عن طريق فحص هلام RNA. تم تصنيع أول حبلا (كدنا) من الحمض النووي الريبي باستخدام النسخ العكسي الفائق (Invitrogen) و oligo (dT) التمهيدي (Sigma). ثم تم استخدام الاشعال الخاصة بالجينات (الجدول 1) لتضخيم شظايا (كدنا) بواسطة تفاعل البوليميراز المتسلسل. تم إجراء PCR باستخدام 1 ميكرولتر من قالب (كدنا) في خليط تفاعل 25 ميكرولتر يحتوي على 3.5 ملي مول لتر -1 MgCl2، 200 ميكرولتر لتر -1 من كل dNTP ، 250 نانومول لتر -1 لكل من البادئات الأمامية والخلفية ، و 1 وحدة دولية. Taq polymerase (New England Biolabs، Toronto، ON، Canada) في محلول تفاعل البوليميراز المتسلسل المزود بالإنزيم. تضمنت جميع تفاعلات PCR تمسخًا أوليًا عند 94 درجة مئوية لمدة 3 دقائق تليها 39 دورة من 94 درجة مئوية لمدة 30 ثانية ، ودرجة حرارة التلدين لمدة 30 ثانية ، و 72 درجة مئوية لمدة 60 ثانية ، وتنتهي بتمديد نهائي لمدة 10 دقائق عند 72 درجة مئوية. تم تنقية منتجات PCR التي تم الحصول عليها بهذه الطريقة ، وتم استنساخها في ناقل pCR2.0-TOPO (مجموعة استنساخ TOPO TA ، Invitrogen) ومتسلسلة. تمت مقارنة التسلسلات الناتجة مع تلك الموجودة في قاعدة بيانات GenBank باستخدام BLASTX لتحديد الجين ، وكذلك لتصميم الاشعال (عند الحاجة) للتضخيم السريع 3′ و 5′ لنهايات cDNA (RACE) لتوسيع أطوال التسلسل المضخم. بالنسبة لـ 3′-RACE ، تم تصنيع (كدنا) باستخدام محول تمهيدي 3′-RACE (Invitrogen) ونسخة عكسية Superscript II (Invitrogen). تم إجراء PCR شبه المتداخلة على (كدنا) باستخدام بادئات تضخيم عالمية مختصرة (AUAP Invitrogen) وأشعال 3′-RACE الخاصة بالجينات (الجدول 1). بالنسبة لـ 5′-RACE ، تم تصنيع (كدنا) باستخدام تمهيدي خاص بالجينات (الجدول 1) ونسخة عكسية سوبيرسكربت II (Invitrogen) ، ثم تمت تنقيتها باستخدام مجموعة تنقية PCR (Sigma). تم ذيل (كدنا) المنقى حديثًا باستخدام dCTP باستخدام ناقل طرفي مؤتلف TdT (Invitrogen) مع ظروف التفاعل النهائي 10 مليمول لتر -1 تريس- حمض الهيدروكلوريك (الرقم الهيدروجيني 8.4) ، 25 مليمول لتر -1 بوكل ، 1.5 مليمول لتر -1 MgCl2، 200 ميكرولتر لتر -1 dCTP ، 1 ميكرولتر (كدنا) ، و 1 ميكرولتر rTdT. تم بعد ذلك استخدام cDNA الذيل لجولتين من PCR باستخدام تمهيدي أمامي خاص بالجينات (الجدول 1) ومثبت تمهيدي 5′ مختلط (5AP Invitrogen) للجولة الأولى ، وتمهيدي أمامي شبه متداخل خاص بالجينات (الجدول 1). 1) و AUAP (Invitrogen) للجولة الثانية. تم استنساخ منتجات PCR في ناقل pCR2.0-TOPO باستخدام مجموعات استنساخ TOPO TA (Invitrogen). تم تأكيد جميع تسلسلات منتج RACE من خلال التداخل مع الجزء الأولي من (كدنا). بعد تكرار التسلسل ثنائي الاتجاه لكلا منتجي RACE ، تم إنشاء تسلسل إجماع من خلال محاذاة تسلسل متعددة باستخدام DNAMAN (v4.0 ، Lynnon Biosoft ، Vaudreuil ، QC ، كندا).

متواليات التمهيدي المستخدمة في استنساخ وتضخيم الأنهيدراز الكربوني لسمك الرئة ، Na + / HCO3 - الناقل المشترك و H + V-ATPase

زوج التمهيدي. التمهيدي إلى الأمام. عكس التمهيدي.
كاليفورنيا MGNCARWSICCIATHGAYAT TTCCARTGNACIARRTGIARYTC
CA3R1 تكاككتكاجاككتجاك
CA3R2 GAGTGCCCATTGTGGAAAT
CA3R3 TCAGCAGTGTGATGTCAATC
QCA تجاككككتجكتجاكاكتكا ACCAATAACAGCCAGCCCGTCAG
ان بي سي كاتجكاججكجتجتتجاجاجت اججككاجتجكتجكتاجاتكج
QNBC تتكتججكتجكتكتكتجت آاتجكتجاككاكاجكوات
HV1 TGYGARTTYCANGGNGAYAT TTCATNGCYTGNACRTCRTT
HV2 غارغاراتغاتكاركانج TTCATNGCYTGNACRTCRTT
HV3R1 تكججاكتتجاجاجاتج
HV3R2 AAGCACTGCGAGAGGTGTCT
HV5R1 تجاكجتككاكجتااتتجت
HV5R2 تجتكاتكاتتجكاتجتك
HV5R3 كجكاجتجكتكاجكاتاجا
QHV CCATGAAGGCGGTAGTCGGTGAG تجججاغاتتكجكاجكاجك
18 ثانية GCCCTATCAACTTTCGATGG جاكاتكتاجككاتكاك
Q18S ججكجكتكككتكجاتجكتكتاكت جتكككتكتاتكاتجككككاجتك
زوج التمهيدي. التمهيدي إلى الأمام. عكس التمهيدي.
كاليفورنيا MGNCARWSICCIATHGAYAT TTCCARTGNACIARRTGIARYTC
CA3R1 تكاككتكاجاككتجاك
CA3R2 GAGTGCCCATTGTGGAAAT
CA3R3 TCAGCAGTGTGATGTCAATC
QCA تجاككككتجكتجاكاكتكا ACCAATAACAGCCAGCCCGTCAG
ان بي سي كاتجكاججكجتجتتجاجاجت اججككاجتجكتجكتاجاتكج
QNBC تتكتججكتجتكتكتكت آاتجكتجاككاكاجكوات
HV1 TGYGARTTYCANGGNGAYAT TTCATNGCYTGNACRTCRTT
HV2 غارغاراتغاتكاركانج TTCATNGCYTGNACRTCRTT
HV3R1 تكججاكتتجاجاجاتج
HV3R2 AAGCACTGCGAGAGGTGTCT
HV5R1 تجاكجتككاكجتااتتجت
HV5R2 تجتكاتكاتتجكاتجتك
HV5R3 كجكاجتجكتكاجكاتاجا
QHV CCATGAAGGCGGTAGTCGGTGAG تجججاغاتتكجكاجكاجك
18 ثانية GCCCTATCAACTTTCGATGG جاكاتكتاجككاتكاك
Q18S ججكجكتكككتكجاتجكتكتاكت جتكككتكتاتكاتجككككاجتك

يتم تقديم جميع البادئات في اتجاه 5 إلى 3

CA ، أنهيدراز الكربونيك NBC ، Na + / HCO3 - cotransporter

باستخدام خلايا الدم الحمراء (كدنا) كقالب ، تم تضخيم مقطع داخلي 315 زوج أساسي (bp) من منطقة تشفير CA (المشار إليها بـ lfCAb) عند درجة حرارة تصلب تبلغ 46 درجة مئوية باستخدام زوج التمهيدي CA (الجدول 1). تم تصميم هذه البادئات المتدهورة بناءً على محاذاة الأشكال الإسوية للفقاريات السيتوبلازمية CA تظهر درجة عالية من حفظ الأحماض الأمينية. تم بعد ذلك تمديد التسلسل بثلاث جولات من 3′-RACE باستخدام بادئات خاصة بالجينات CA3R1 و CA3R2 و CA3R3.

تم تضخيم قطعة داخلية تبلغ 665 نقطة أساس من منطقة تشفير NBC عند درجة حرارة التلدين البالغة 57 درجة مئوية باستخدام cDNA المشتق من أنسجة خياشيم أسماك الرئة وزوج التمهيدي NBC. تتوافق هذه البادئات مع النيوكليوتيدات في المواضع 1492-1512 و 2183-2203 من السمندل النمر (أمبيستوما تيغرينوم) NBC للكلى (رقم انضمام GenBank AF001958) (Romero et al. ، 1997). تم اعتبار الاستنساخ الناتج ، lfNBC ، بطول كافٍ لأغراض الدراسة الحالية ، وبالتالي لم يتم إجراء أي محاولة لتمديد طول التسلسل باستخدام RACE.

باستخدام نسيج خياشيم سمك الرئة ، تم تضخيم جزء داخلي من منطقة الترميز للوحدة الفرعية B من النوع V H + -ATPase (المشار إليه بـ lfH + V-ATPase) باستخدام زوج التمهيدي HV1 عند درجة حرارة تصلب 50 درجة مئوية. هذه البادئات ، التي تم استخدامها بنجاح بواسطة بيري وآخرون (بيري وآخرون ، 2000) لاستنساخ الوحدة الفرعية لتروتة قوس قزح من النوع V + -ATPase B ، تتوافق مع النيوكليوتيدات في المواضع 441-461 و 1395-1415 من الكلية البقريّة من النوع V-type H + -ATPase B تسلسل الوحدة الفرعية (GenBank accession no. M88691) (Nelson et al.، 1992). كانت هناك حاجة إلى جولة ثانية من PCR للحصول على جزء 810 نقطة أساس. استخدمت جولة PCR زوج التمهيدي HV2 عند درجة حرارة تلدين تبلغ 49 درجة مئوية. التمهيدي الأمامي الجديد يتوافق مع النيوكليوتيدات في المواضع 606-626 من كلية الأبقار H + V-ATPase. تم تمديد طول التسلسل بعد ذلك بجولتين من 3′-RACE باستخدام بادئات خاصة بالجينات HV3R1 و HV3R2 ، وبواسطة 5′-RACE. بالنسبة لـ 5′-RACE ، تم استخدام التمهيدي الخاص بالجينات HV5R1 لتوليف (كدنا). ثم تم تنفيذ جولتين من 5′-RACE باستخدام بادئات خاصة بالجينات HV5R2 و HV5R3.

التأثير على الحالة الحمضية القاعدية لسمك الرئة الأفريقي بروتوبتروس أنيكتينز من ساعة واحدة من حمض (أ - د) (3 مليمول كجم -1 NH4Cl) أو (E - H) قاعدة (3 ملمول كجم -1 NaHCO3) التسريب. تم تقييم حالة القاعدة الحمضية قبل وبعد فترة التسريب (المميزة بالشريط الرمادي) من خلال تحديد الأس الهيدروجيني (A ، E) ، HCO3 - تركيز الأيونات ([HCO3 -]) (B ، F) و CO2توتر (صأكو2) (C ، G) من الدم الشرياني. (D ، H) درجة الحموضة - HCO3 - تُستخدم الرسوم البيانية لتلخيص تأثير التسريب الحمضي أو القاعدي على حالة القاعدة الحمضية. القيم تعني ± sem ن= 11 للأسماك المشبعة بالحمض و ن= 6-8 للأسماك المغموسة في القاعدة. تشير علامة النجمة (*) إلى اختلاف كبير عن قيمة التسريب المسبق (مقاييس متكررة أحادية الاتجاه ANOVA ص القيم موضحة في الشكل). بالنسبة للأس الهيدروجيني- HCO3 - الرسوم البيانية صكو2 لمجموعة معينة من الأس الهيدروجيني و [HCO- 3] باستخدام معادلة Henderson-Hasselbalch والقيم المناسبة لـ pK′ و صأكو2(بوتيلير وآخرون ، 1984). تم إنشاء الخط العازل باستخدام بيانات لـ Protopterus aethiopicus(لينفانت ويوهانسن ، 1968). فترة ما قبل التسريب الحمضي أو القاعدي.

التأثير على الحالة الحمضية القاعدية لسمك الرئة الأفريقي بروتوبتروس أنيكتينز من ساعة واحدة من حمض (أ - د) (3 مليمول كجم -1 NH4Cl) أو (E - H) قاعدة (3 ملمول كجم -1 NaHCO3) التسريب. تم تقييم حالة القاعدة الحمضية قبل وبعد فترة التسريب (المميزة بالشريط الرمادي) من خلال تحديد الأس الهيدروجيني (A ، E) ، HCO3 - تركيز الأيونات ([HCO3 -]) (B ، F) و CO2توتر (صأكو2) (C ، G) من الدم الشرياني. (D ، H) درجة الحموضة - HCO3 - تُستخدم الرسوم البيانية لتلخيص تأثير التسريب الحمضي أو القاعدي على حالة القاعدة الحمضية. القيم تعني ± sem ن= 11 للأسماك المشبعة بالحمض و ن= 6-8 للأسماك المغموسة في القاعدة. تشير علامة النجمة (*) إلى اختلاف كبير عن قيمة التسريب المسبق (مقاييس متكررة أحادية الاتجاه ANOVA ص القيم موضحة في الشكل). بالنسبة للأس الهيدروجيني- HCO3 - الرسوم البيانية صكو2 لمجموعة معينة من الأس الهيدروجيني و [HCO- 3] باستخدام معادلة Henderson-Hasselbalch والقيم المناسبة لـ pK′ و صأكو2(بوتيلير وآخرون ، 1984). تم إنشاء الخط العازل باستخدام بيانات لـ Protopterus aethiopicus(لينفانت ويوهانسن ، 1968). فترة ما قبل التسريب الحمضي أو القاعدي.

تحليلات التطور والتسلسل

تمت محاذاة تسلسلات الأحماض الأمينية المستخلصة من أسماك الرئة مع تسلسلات GenBank التي تم عرض هوية عالية بها (تم تحديدها بواسطة بحث BLASTX في قواعد بيانات GenBank) باستخدام ClustalX الإصدار 1.83 (Thompson et al. ، 1997) مع فرض عقوبات على فتح الفجوة وتمديد الفجوة إلى 30 و 0.75 ، على التوالي ، للمحاذاة الزوجية ، و 15 و 0.3 على التوالي للمحاذاة المتعددة. لاحظ أنه تم اقتطاع التسلسلات كاملة الطول من الفقاريات الأخرى بشكل مناسب لمقارنة المناطق المتداخلة فقط مع متواليات أسماك الرئة. تم استخدام حزمة PHYLIP بعد ذلك لإجراء تحليل النشوء والتطور المرتبط بالجوار (Saitou and Nei ، 1987) على مصفوفة من مسافات الأحرف المتوسطة ، مع خيار إعادة تشكيل التمهيد لتقييم دعم العقد (100 pseudoreplicates). بشكل عام ، تم استخدام المعلمات الافتراضية فيما عدا أنه تم تحديد المجموعة الخارجية (مثل ذبابة الفاكهة) وكان ترتيب إدخال الأنواع عشوائيًا حيثما أمكن ذلك. يتم عرض أرقام الانضمام للتسلسلات المستخدمة في المحاذاة أو تحليل النشوء والتطور في أساطير الشكل المناسب.

التأثير على تواتر تنفس الهواء (أ ، ب) (Fهواء أ) والماء (Fماء ب) و (ج ، د) كو2 إفراز في الهواء (هواءكو2 ج) والماء (ماءكو2D) ، من حمض 1 ساعة (3 ملي مول كجم -1 NH4Cl) التسريب (المميز بالشريط الرمادي) في الأسماك الرئوية الأفريقية بروتوبتروس أنيكتينز. القيم تعني ± sem للفترة التي تسبق التسريب الحمضي ("قبل") ، وللفترات القياس 0-1 ، و2-3 ، و5-6 ، و17-18 ساعة بعد التسريب ن= 9-11 لترددات التنفس و ماءكو2، و 8 من أجل هواءكو2. تشير علامة النجمة (*) إلى زيادة كبيرة في قيمة التسريب المسبق (طريقة واحدة RM-ANOVA ص القيم موضحة في الشكل) لاحظ أنه في A ، آخر مخصص لم تتمكن اختبارات المقارنات المتعددة من اكتشاف أصل الاختلاف الكبير الذي أشار إليه صالقيمة.

التأثير على تواتر تنفس الهواء (أ ، ب) (Fهواء أ) والماء (Fماء ب) و (ج ، د) كو2 إفراز في الهواء (هواءكو2 ج) والماء (ماءكو2D) ، من حمض 1 ساعة (3 ملي مول كجم -1 NH4Cl) ضخ (يتميز بالشريط الرمادي) في الأسماك الرئوية الأفريقية بروتوبتروس أنيكتينز. القيم تعني ± sem للفترة التي تسبق التسريب الحمضي ("قبل") ، وللفترات القياس 0-1 ، و2-3 ، و5-6 ، و17-18 ساعة بعد التسريب ن= 9-11 لترددات التنفس و ماءكو2، و 8 من أجل هواءكو2. تشير علامة النجمة (*) إلى زيادة كبيرة في قيمة التسريب المسبق (طريقة واحدة RM-ANOVA ص القيم موضحة في الشكل) لاحظ أنه في A ، آخر مخصص لم تتمكن اختبارات المقارنات المتعددة من اكتشاف أصل الاختلاف الكبير الذي أشار إليه صالقيمة.

الوقت الحقيقي PCR

تم استخدام تفاعل البوليميراز المتسلسل في الوقت الحقيقي لتقييم التعبير عن العديد من الرنا المرسال لسمك الرئة في أنسجة الخياشيم والكلى تحت ظروف تحكم وبعد التسريب الحمضي أو الأساسي. تم استخراج إجمالي الحمض النووي الريبي باستخدام Trizol (Invitrogen) من الأنسجة التي تم تجانسها إلى مسحوق تحت سائل N2 بالهاون والمدقة ، ثم تمر عبر إبرة باستخدام حقنة. تمت معالجة إجمالي الحمض النووي الريبي المستخرج باستخدام درجة تضخيم DNase I (إنفيتروجين خالٍ من RNase) وفقًا لتعليمات الشركة الصانعة لمدة 15 دقيقة عند درجة حرارة الغرفة ، تليها 10 دقائق عند 70 درجة مئوية ، لإزالة أي DNA جيني متبقي. تم التحقق من جودة الحمض النووي الريبي عن طريق القياس الطيفي (الأجهزة الجزيئية ، Sunnyvale ، كاليفورنيا ، الولايات المتحدة الأمريكية) ثم تم تصنيع cDNA من 2 ميكروغرام من الحمض النووي الريبي باستخدام بادئات سداسية عشوائية (IDT DNA) و RevertAid M-MuLV H-minus (Fermentas ، Burlington ، ON ، كندا) وفقًا لتعليمات الشركة المصنعة. تم استخدام مجموعة رائعة SYBR Green QPCR Master Mix (Stratagene ، Cedarlane Laboratories ، Hornby ، ON ، كندا) ونظام Stratagene MX-4000 متعدد الإرسال PCR لتنفيذ PCR في الوقت الفعلي ، مع ROX (Stratagene) كصبغة مرجعية. كانت ظروف PCR (حجم التفاعل النهائي 25 ميكرولتر) على النحو التالي: قالب (كدنا) 1 ميكرولتر (لاحظ أنه بالنسبة لـ 18S ، تم تخفيف (كدنا) 1000 ضعف) ، 100 نانومول لتر -1 بادئات أمامية وعكسية ، 12.5 ميكرولتر من 2 × مزيج رئيسي ، 0.375 ميكرولتر من 1: 1500 ROX التخفيف النهائي. كانت درجات حرارة التلدين والتمديد أكثر من 40 دورة ، على التوالي ، 58 درجة مئوية (30 ثانية) و 72 درجة مئوية (30 ثانية). تم تصميم أزواج التمهيدي لكل جين من جينات السمكة الرئوية و Lungfish 18S باستخدام برنامج Primer3 وتم سردها في الجدول 1 (تم استخدام الأزواج المعينة `` Q '' لـ PCR في الوقت الفعلي). تم استنساخ قطعة 1150 نقطة أساس من سمك الرئة 18S من أنسجة الخياشيم باستخدام الطرق الموضحة أعلاه وزوج التمهيدي 18S (الجدول 1 درجة حرارة التلدين 52 درجة مئوية) ، والذي يتكون من بادئات مصممة ضد مناطق حفظ الأحماض الأمينية العالية المحددة من خلال فحص محاذاة متواليات 18S من مجموعة من الفقاريات. تم استخدام التسلسل بعد ذلك لتصميم بادئات PCR 18S في الوقت الفعلي المدرجة في الجدول 1. تم التحقق من خصوصية كل زوج من التمهيدي بواسطة الاستنساخ (مجموعة استنساخ TOPO TA Invitrogen) وتسلسل المنتج المضخم. تم إنشاء منحنيات التفكك الأخضر SYBR بعد الانتهاء من 40 دورة PCR وكشفت عن وجود أمبليكون واحد لكل زوج تمهيدي. تم استخدام حذف النسخ العكسي أثناء تخليق (كدنا) كعنصر تحكم لضمان عدم تضخيم الحمض النووي الجيني المتبقي. للمقارنات بين المعالجات (الضبط ، الحمض المغروس ، القاعدة) ، تم حساب تعبير mRNA المتعلق بمجموعة التحكم باستخدام طريقة delta-delta Ct المعدلة (Pfaffl ، 2001) مع تعبير Lungfish 18S mRNA كعامل تطبيع.

التأثير على تواتر تنفس الهواء (أ ، ب) (Fهواء أ) والماء (Fماء ب) و (ج ، د) على أول أكسيد الكربون2 إفراز في الهواء (هواءكو2 ج) والماء (ماءكو2D) ، من قاعدة 1 ساعة (3 ملمول كجم -1 NaCO3) التسريب (المميز بالشريط الرمادي) في الأسماك الرئوية الأفريقية بروتوبتروس أنيكتينز. القيم تعني ± sem للفترة السابقة للتسريب الأساسي ("قبل") ، وللفترات القياس 0-1 ، و2-3 ، و5-6 ، و17-18 ساعة بعد التسريب ن= 8 في كل مكان. تشير علامة النجمة (*) إلى اختلاف كبير عن قيمة التسريب المسبق (طريقة واحدة RM-ANOVA ص القيم موضحة في الشكل).

التأثير على تواتر تنفس الهواء (أ ، ب) (Fهواء أ) والماء (Fماء ب) و (ج ، د) على أول أكسيد الكربون2 إفراز في الهواء (هواءكو2 ج) والماء (ماءكو2D) ، من قاعدة 1 ساعة (3 ملمول كجم -1 NaCO3) التسريب (المميز بالشريط الرمادي) في الأسماك الرئوية الأفريقية بروتوبتروس أنيكتينز. القيم تعني ± sem للفترة السابقة للتسريب الأساسي ("قبل") ، وللفترات القياس 0-1 ، و2-3 ، و5-6 ، و17-18 ساعة بعد التسريب ن= 8 في كل مكان. تشير علامة النجمة (*) إلى اختلاف كبير عن قيمة التسريب المسبق (طريقة واحدة RM-ANOVA ص القيم موضحة في الشكل).

تحاليل احصائية

تم الإبلاغ عن البيانات على أنها قيم متوسطة ± 1 sem تم تقييم الأهمية الإحصائية لتأثيرات العلاج عن طريق تحليل المقاييس المتكررة في اتجاه واحد للتباين (RM-ANOVA). حيثما أشارت RM-ANOVA أحادية الاتجاه إلى وجود اختلافات كبيرة ، أ آخر مخصص تم تطبيق اختبار المقارنات المتعددة (طريقة هولم - سيداك). في حالة انتهاك افتراضات الحالة الطبيعية أو التباين المتساوي ، تم استخدام اختبارات غير بارامترية مكافئة. تم إجراء التحليلات الإحصائية باستخدام برنامج SPSS SigmaStat v3.0 (Systat Software) بحد ايماني من الأهمية في جميع الاختبارات يبلغ 0.05.


المتطلبات المعدنية للأسماك

المعادن هي نوع من العناصر الأساسية. العناصر المعدنية هي العناصر غير العضوية المطلوبة لإدارة وصيانة العمليات الفسيولوجية الهامة في الكائن الحي. بعض المعادن الهامة هي الكالسيوم والفوسفور والصوديوم والكبريت وما إلى ذلك.تعمل المعادن كمحفزات بيولوجية للإنزيمات والهرمونات والبروتين في الجسم.

يؤدي حوالي 23 نوعًا من المعادن غير العضوية الوظائف الضرورية في الكائن الحي. من بين هؤلاء ، 7 هي المعادن التي يحتاجها الجسم بكميات كافية ويشار إلى هذه المعادن بالعناصر الكلية. من ناحية أخرى ، هناك حاجة إلى 16 معدنًا بكميات صغيرة جدًا في جسم الكائن الحي ، وتسمى هذه المعادن بالعناصر الدقيقة أو المعادن النادرة.

تلعب العناصر الثانوية دورًا رئيسيًا في تغذية وإنتاج الأسماك جنبًا إلى جنب مع المعادن الأخرى. يعمل الغذاء والماء التكميليان كمصدر للمعادن السمكية. يمكن للأسماك امتصاص هذه العناصر على شكل أيونات بمساعدة الخياشيم والجلد. سمك روي (لابيو روهيتا) الحصول على المعادن الأساسية من العوالق وحيوانات قاع الأحواض والمواد العضوية المتحللة. في حالة عدم وجود مثل هذه العناصر ، ينخفض ​​نمو الأسماك أو تحدث الأمراض بسبب الآفات ، كما أن وجودها المرتفع يعيق معدل نمو الأسماك. لا تمتص الأسماك هذه العناصر الغذائية غير العضوية من خلال الغذاء فحسب ، بل تمتص أيضًا من البيئة المائية الخارجية. ترتبط العناصر غير العضوية ارتباطًا وثيقًا بطريقة عيش الأسماك.


استنتاج

أدت التطورات الحديثة في فسيولوجيا الجسم - القاعدة الحمضية وكذلك علم الأوبئة إلى صورة أوضح بكثير عن الاضطرابات الأيضية الحمضية - القاعدية في الحالات الحرجة والمصابين. أصبح من الممكن الآن "إعادة توحيد" الأساليب الوصفية التقليدية للتوازن الحمضي القاعدي مع التقنيات الكمية الحديثة. هذا النهج الموحد بسيط وشفاف ويمكن استخدامه بسهولة بجانب السرير. يجب أن تساعد أيضًا في الوصول إلى الجزء الأكبر من الأدبيات السريرية وتفسيرها. كما كان الاتجاه السائد بالفعل ، فإن الدراسات الأحدث لفيزيولوجيا القاعدة الحمضية ستستفيد بلا شك من التقنيات الكمية مع الاستمرار في الإبلاغ عن المزيد من المتغيرات التقليدية.


شاهد الفيديو: الجزء الاول من محاضره بعنوان Fluid, electrolytes and acid-base balance (ديسمبر 2022).